Skip to main content

Table 2 Sequence-specific primer pairs for typing the HLA DQB1 * 03 locus

From: Association Between HLA DQBl * 03 and Cervical Intra-epithelial Neoplasia

HLA Allele Primer Sequences FAMP/RAMP Size/PCR Product (bp)
DQB1 * 0201 5′ GTGCGTCTTGTGAGCAGAAG 3′ 5′ GCAAGGTCGTGCCGAGCT 3′ 205
DQB1 * 0201/0302 5′ GACGGAGCGCGTGCGTCT 3′ 5′CTGTTCCAGTACTCGGCGG 3′ 129
DQB1 * 0301/0304 5′ GACGGAGCGCGTGCGTTA 3′ 5′ AGTACTCGGCGTCAGGCG 3′ 122
DQB1 * 0302/0303 5′ GACGGAGCGCGTGCGTTA 3′ 5′ AGTACTCGGCGTCAGGCG 3′ 122
DQB1 * 0303 5′ GACGGAGCGCGTGCGTTA 3′ 5′ CTGTTCCAGTACTCGCGT 3′ 129
DQB1 * 0601 5′ GCCATGTGCTACTTCACCAAT 3′ 5′ CACCGTGTCCAACTCCGCT 3′ 198
DQB1 * 0601/0301 5′ GACGGAGCGCGTGCGTTA 3′ 5′ CTGTTCCAGTACTCGGCGT 3′ 129
DQB1 * 0304 5′ GACGGAGCGCGTGCGTTA 3′ 5′ CTGTTCCAGTACTCGGCGG 3′ 129
  1. FAMP Forward amplification primer; RAMP reverse amplification primer.