Skip to content

Advertisement

  • Original Articles
  • Open Access

Oligoclonality of CD8+ T Cells in Breast Cancer Patients

  • 1,
  • 1,
  • 1,
  • 2,
  • 3,
  • 4,
  • 1 and
  • 1
Molecular Medicine19973:BF03401720

https://doi.org/10.1007/BF03401720

  • Accepted: 10 October 1997
  • Published:

Abstract

Substantial evidence has suggested that T cells play an important role in antitumor immunity. T cells with cytotoxic activity against tumors have been isolated from in vitro culture of tumor-infiltrated lymphocytes of cancer patients. In addition, clonal expansions of T cells have been identified in lesions of tumors by using a PCR-based CDR3 analysis of T cell receptors (TCR). Since the CDR3 region of the T cell receptor directly interacts with the antigen-MHC complex and is thus highly polymorphic, a dominant CDR3 length in a particular TCR Vβ population will indicate the clonal expansion of a specific T cell clone. Utilizing this technique, we have analyzed the T cell repertoire in lymph nodes (LNs) and peripheral blood of 20 breast cancer patients. Our results show that in most cases, peripheral blood mononuclear cells (PBMCs) and LN express dominant CD8+ T cell clones in different Vβ gene families, and the number of dominant clones is higher in PBMC than in the LN. Furthermore, in 7 out of 16 patients’ lymph nodes, there is a dominant Vβ18 T cell clonal expansion in the CD8+ T cell subset. The frequency of an oligoclonal expansion of Vβ18 CD8+ T cells in non-breast cancer lymph nodes is 1 out of 9, but no obvious motif in the CDR3 region of Vβ18 TCR can be identified. The prevalence of the clonal dominance found in breast cancer is discussed in the context of a possible tumor-related antigen stimulation.

Introduction

A large body of evidence indicates that T cells play an important part in antitumor immunity (1). Tumor-specific T cells have been found in tumor-bearing patients, and many human solid tumors are infiltrated by T cells (2,3). In some cases, the presence of tumor-infiltrating lymphocytes (TILs) has been considered to be a favorable prognostic indicator, as T cell infiltration of the tumor is felt to reflect the patient’s ability to develop an immune response against the tumor (4,5). The development of tumor immunity suggests that new antigen determinants may emerge during the transformation from normal to malignant cells, and that these new non-self antigens can be detected by T cells (613). Indeed, T cells isolated from tumor sites express activation markers indicating in vivo activation by antigens (1420). Furthermore, the antitumor activity of these T cells can be demonstrated by their ability to proliferate, secrete cytokines, or induce cytolysis of target cells when they encounter tumor cells in vitro (2125).

Each T cell is characterized by the expression of a unique T cell receptor (TCR), which is composed of an α- and a β-chain (2628). PCR analysis indicates that in some, but not all tumors, there is a dominant usage of a particular V gene by TILs, suggesting that they may be elicited by a common antigen (17, 18, 29). The hypervariable CDR3 region of the TCR, containing the V(D)J junction, is thought to carry the fine specificity of antigen recognition (30). The length of the CDR3 region varies from 6 to 14 amino acids. In general, there is a Gaussian distribution of CDR3 length among TCR using a particular V gene family. Upon antigen stimulation, a dominant CDR3 length may emerge, which represents the expansion of a specific antigen-reactive T cell clone (31). Therefore, examining the CDR3 length is not only another means of analyzing T cell repertoire diversity but it can also provide information on the clonality of T cells (32, 33). By using this technique, several investigators have shown clonal expansion in TILs of melanoma, glioma, and other solid tumors (3437).

The majority of breast cancer-specific cytotoxic T lymphocytes (CTLs) that have been characterized were generated by in vitro stimulation with allogenic tumor cells or tumor-antigenic peptides and were expanded in the presence of interleukin 2 (IL-2). They can be either CD4+ or CD8+ T cells with cytotoxic activity against tumor cell lines (3840). In general, T cells isolated from patients’ axillary lymph nodes have been used as a source of tumor-infiltrating lymphocytes as these lymph nodes directly drain the tumor and so would be expected to be enriched for specific breast cancer-reactive lymphocytes. In vitro oligoclonal expansion of these propagated CTLs may sometimes be found. However, these cells may reflect an artifact, such as random outgrowth in culture (4143). Therefore, it is important to determine whether a tumor-specific local response exists in vivo. Furthermore, it should be advantageous to analyze the repertoire of TTLs at a resolution permitting the detection of potential tumor-specific clonal expansions in breast cancer patients. Therefore, we decided to perform CDR3 length analysis to examine potential tumor-specific clonal expansion of T cells in breast cancer patients’ blood and LNs.

Materials and Methods

Lymph Node and Blood Preparation

Blood was drawn from breast cancer patients prior to their surgical procedure. After surgery, lymph nodes were obtained from pathologic specimens of surgical dissections from the same patients. Lymph nodes were selected and sterilely sectioned into two equal parts. One-half of the lymph node was used for immediate histologic analysis. At the same time, the other half of the lymph node sample was placed in a conical tube with sterile RPMI 1640 medium. This sample was then passed through a wire mesh to obtain a single-cell suspension. The typical yield of lymphocytes for this procedure was between 5 and 10 million cells. Controls consisted of LNs of non-breast cancer patients that were obtained from autopsy samples. Blood (30–50 ml) was obtained from healthy female volunteers whose ages ranged from 40 to 80.

T Cell Isolation and RNA Preparation

Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood and mononuclear cells were isolated from a single-cell suspension of lymph nodes by Ficoll-Hypaque centrifugation. CD4+ or CD8+ T cells were then subjected to positive selection by using anti-CD4- or anti-CD8-coated magnetic beads (Dynal, Great Neck, NY). RNA was extracted directly from bead-bound cells by using RNAzol according to the manufacturer’s instructions (Biotecx, Houston, TX).

CDR3 Length Analysis

Total cellular RNA was extracted from 1 × 105 T cells and reverse transcribed into cDNA with a TCR Cβ anti-sense primer. Each Vβ-specific DNA fragment was generated from a portion of first-strand cDNA reaction mixture, using polymerase chain reaction (PCR) technique with the same Cβ anti-sense primer and a Vβ-specific sense primer (Table 1). The PCR reaction consisted of 35 cycles of 30 sec at 94°C, 30 sec at 55°C, and 1 min at 72°C and an additional extension cycle at 72°C for 10 min. One to two microliters of this first PCR reaction product was then reamplified with a nested Vβ-specific sense primer and a 32P-labeled Cβ anti-sense primer for another 15 thermal cycles (33). The second PCR product was separated on a 6% acrylamide sequencing gel and visualized by overnight exposure to Kodak AR film. The radioactivity of each DNA fragment was analyzed on a Phosphorimager (Molecular Dynamics, CA). The dominant band was defined as that containing more than 50% of the combined radioactivity of all bands in that particular Vβ family.
Table 1

Sequence of primers used

Primers

 

Sequence (5′–3′)

First-step PCR

 

Nested primers

BV1

CAACAGTTCCCTGACTTGCAC

CTCAGCTTTGTATTTCTGTG

BV2

TCAACCATGCAAGCCTGACCT

CAGCAGCCTCTACATCTGCA

BV3

TCTAGAGAGAAGAAGGAGCGC

GACATCTATGTACCTCTGTG

BV4

CATATGAGAGTGGATTTGTCATT

CAGCAGCATATATCTCTGCA

BV5

CCTAACTATAGCTCTGAGCTG

CTCGGCCCTCTATCTCTGTG

BV6

AGGCCTGAGGGATCCGTCTC

CTC(G or C or A)GCC(G or A)TGTATCTCTGTG

BV7

CTGAATGCCCCAACAGCTCTC

CTC(G or A)GCCCTGTATCTCTGCG

BV8

TACTTTAACAACAACGTTCCG

CTCAGCTGTGTACTTCTGTG

BV9

AAATCTCCAGACAAAGCTCAC

CTCTGCTGTGTATTTCTGTG

BV10

CAAAAACTCATCCTGTACCTT

CACAGCACTGTATTTCTGTG

BV11

ACAGTCTCCAGAATAAGGACG

TACCTCTCAGTACCTCTGTG

BV12

GACAAAGGAGAAGTCTCAGAT

GACATCTGTGTACTTCTGTG

BV13.1

GACCAAGGAGAAGTCCCCAAT

GACATCTGTGTACTTCTGTG

BV13.2

GTTGGTGAGGGTACAACTGCC

GACATCTGTGTACTTCTGTG

BV14

TCTCGAAAAGAGAAGAGGAAT

GACCTCTCTGTACTTCTGTG

BV15

GTCTCTCGACAGGCACAGGCT

GACAGCTCTTTACTTCTGTG

BV16

GAGTCTAAACAGGATGAGTCC

TTCTGGAGTTTATTTCTGTG

BV17

CACAGATAGTAAATGACTTTCAG

GACAGCTTTCTATCTCTGTG

BV18

GAGTCAGGAATGCCAAAGGAA

TTCGGCAG(G or C)TTATTTCTGTG

BV19

CCCCAAGAACGCACCCTGC

CACGGCACTGTATCTCTGCG

BV20

TCTGAGGTGCCCCAGAATCTC

CTCTGGCTTCTATCTCTGTG

CB-14

CTCAGCTCCACGTG

 

CB-R

CTTCTGATGGCTCAAACAC

 

BJ primer used for sequencing

 

BJ1S1

AACTGTGAGTCT GGTGCCTT

 

BJ1S2

ACGGTTAACCTG GTCCCCGA

 

BJ1S3

CTCTACAACAGT GAGCCAAC

 

BJ1S4

GACAGAGAGCTG GGTTCCAC

 

BJ1S5

TGGAGAGTCGAG TCCCATCA

 

BJ1S6

TGAGCCTGGTCC CATTCCCA

 

BJ2S1

CCTCTAGCACGG TGAGCCGT

 

BJ2S2

TACGGTCAGCCT AGAGCCTT

 

BJ2S3

CTGTCAGCCGGG TGCCTGGG

 

BJ2S4

CTGAGAGCCGGG TCCCGGCG

 

BJ2S5

CCTCGAGCACCA GGAGCCGC

 

BJ2S6

CCTGCTGCCGGC CCCGAAAG

 

BJ2S7

TGACCGTGAGCC TGGTGCCC

 

BV: TCR Vβ; BJ: TCR Jβ; CB: TCR Cβ.

CB-14 was used for first-strand cDNA synthesis, and CB-R was used for sequencing.

CDR3 Region Sequencing

After CDR3 analysis, the dominant band of the Vβ18 gene family was cut out of the acrylamide gel, extracted in H2O, and purified using the PCR Prep DNA purification kit, according to the manufacturer’s instructions (Promega). Purified DNA fragments were sequenced using fluorescent dideoxy nucleotides and a Cβ reverse primer on an Applied Biosystem Model 373A Automatic Sequencer. If ambiguous sequences were found, additional sequencing was carried out using a Jβ-specific reverse primer (44).

In some cases, readable sequences could not be obtained from direct sequencing. We then determined the sequence by bacterial cloning. Vβ18 TCR DNA fragments were generated by PCR technique with a Vβ18-specific forward primer and a Cβ reverse primer and ligated into a pAMP1 vector according to the manufacturer’s instructions (Gibco/BRL). Ligated plasmids were transformed into DH5-competent cells, positive clones were selected, and those clones containing correct inserts were amplified and plasmid DNAs were isolated and purified by using Minipreps DNA purification kit (Promega). Purified plasmid DNA was sequenced using the automatic sequencer.

Results

LN and PBMC CD8+ T Cells of Breast Cancer Patients Exhibit Different CDR3 Size Patterns

In the antigen-specific immune response, there may be limited T cell clone(s) generated in response to the eliciting antigen(s), and their proliferation or activation may not be prominent enough to be detected by mRNA analysis or immunofluorescence methods. Recently, however, several laboratories have used CDR3 region analysis of TCR to examine clonal expansion of T cells; previously, this could not be done by semiquantitative RT-PCR techniques (3137). Although to date, no dominant T cell receptor usage has been observed in breast cancer patients (29), tumor antigens may stimulate an oligoclonal expansion of a subset of T cells. We therefore decided to examine the oligoclonality of both CD4 and CD8 T cells in the lymph nodes and blood of patients with breast cancer.

Sixteen lymph nodes and eleven blood samples from 20 breast cancer patients were analyzed; 7 patients had paired blood and LN samples. One patient had noninvasive tumor and four had microinvasive intraductal type tumor. Fifteen had invasive-type tumors, and five of them had involved nodes (see Table 2). The distribution of CDR3 length of TCRVβ gene families was visualized by using radioactive Cβ primers, and the radioactivity of each band was then measured and analyzed using a Phosphorimager. Since TCR Vβ19 and 10 genes contain nonfunctional gene segments, we eliminated these Vβs from our analysis (44). Figure 1 shows that in the CD4+ T cell compartment of both lymph node and PBMCs of five breast cancer patients, there is a Gaussian distribution in the CDR3 length of all TCRVβ families, whereas in the CD8+ T cell compartment, a dominant CDR3 size can be seen in many Vβ gene families. Previous studies have demonstrated that most of the dominant bands observed in CDR3 analysis contain a single dominant sequence, suggesting a clonal expansion in that Vβ gene family (33). Comparing the clonality in the PBMCs and LN of the same patient, our data show that in most cases, the PBMC and LN express dominant CD8+ T cell clones in different Vβ gene families. In addition, the number of dominant clones is higher in PBMCs than in the LN (Fig. 2).
Table 2

Description of Breast Cancer Patients

Patients

Age

Primary tumor

Positive nodes

HLA haplotype

Specimen

A

B

C

S.G.

39

Noninvasive, ductal

0

   

LN, PBL

D.C.

47

Microinvasive, ductal

0

   

LN, PBL

E.H.

61

Microinvasive, ductal

0

   

LN, PBL

B.F.

45

Microinvasive, ductal

0

   

LN, PBL

G.L.

60

Microinvasive, lobular

0

   

PBL

D.M.

63

Invasive, ductal

0

2,3

18,53

4,7

LN, PBL

M.T.

76

Invasive, ductal

0

26,30

18,38

5.8

LN, PBL

C.D.

56

Invasive, medullary

0

2,11

45,50

6,7

LN

M.B.

56

Invasive, lobular

0

2,26

44,50

6,7

LN

I.L.

66

Invasive, ductal

0

   

LN

D.D.

40

Invasive, lobular

0

1,25

8,37

7,—

LN

V.V.

55

Invasive, ductal, lobular

0

   

LN

J.W.

59

Invasive, ductal

0

   

LN

J.K.

65

Invasive, ductal

0

   

LN

M.Z.

58

Invasive, cystosarcoma phylloides

0

   

PBL

P.V.

40

Invasive, medullary

2/23

24,30

44,52

4,7

LN, PBL

H.E.

72

Invasive, ductal

8/19

2,24

39,57

6,7

LN

H.H.

69

Invasive, lobular

23/39

2,23

44,50

5,6

LN

I.D.

70

Invasive, ductal

6/19

   

PBL

J.P.

49

Invasive, ductal

22/22

   

PBL

Fig. 1
Fig. 1

CDR3 length analysis of T cells isolated from peripheral blood (PB) (A, B) and lymph nodes (LN) (C, D) of breast cancer patients

Mononuclear cells were isolated from PB or LN and CD4+ (A,C) and CD8+ (B,D) cells were positively selected by magnetic beads (see Materials and Methods). CDR3 lengths were analyzed by using a two-step PCR technique with 32P-labeled C, β reverse primer.

Fig. 2
Fig. 2

Presence of dominant CD8 + T cell clone in each TCR V β family of seven breast cancer patients: E.H., M.T., S.G., D.C., D.M., P.V., and B.F.

Radioactivity of each band on acrylamide gels (see Fig. 1) was collected and analyzed on a Phosphorimager. The dominant band was determined by the criteria described in Materials and Methods. ■, LN; □, PBMC.

Although clonal expansion is a common feature of the CD8+ population in normal individuals, the average number of TCR families expressing clonal dominance is approximately 1.7. In breast cancer PBMCs and breast cancer LN, the average numbers are 4.5 and 2.5, respectively. Because the frequency of oligoclonality increases with age (45) and the average age of breast cancer patients in our study is 59, we examined the oligoclonality in PBMC CD8+ T cells of 15 age-matched healthy females (ages 40 to 80) and in LN CD8+ T cells of 9 non-breast cancer patients (ages 60 to 80). Dominant CDR3 size distribution can also been seen in LN CD8+ T cells of non-breast cancer patients (Fig. 3) as well as in the PMBC CD8+ T cells of healthy individuals (data not shown). The average number of Vβ gene families expressing clonal expansion for non-breast cancer PBMCs and non-breast cancer LN are 2.7 and 1.2, respectively. Therefore, the number of Vβ gene families containing dominant CDR3 length is slightly increased in CD8+ T cells of breast cancer patients.
Fig. 3
Fig. 3

CDR3 length analysis of CD8 + T cells isolated from LNs of five non-breast cancer patients

The CDR3 length distributions of CD8+ T cells, isolated from autopsy LN samples, were analyzed according to procedures described in Materials and Methods.

The Presence of Dominant CD8+ T Cell Clones in Breast Cancer Patients’ LN

The distributions of the oligoclonal frequency of TCR Vβ gene families among the CD8+ T cells in PBMCs of breast cancer and non-breast cancer patients are similar (Fig. 4A). However, the distributions in LNs are quite different in breast cancer and non-breast cancer patients. In non-breast cancer patients’ LNs, the oligoclonality of CD8+ T cells is clustered in just a few Vβ gene families (Fig. 4B), and in 4 out of 9 individuals a dominant clone in the Vβ12 family is expressed. On the other hand, the distribution of oligoclonality in breast cancer patients’ LNs is spread out in many more Vβ gene families, and in 7 out of 16 patients a dominant clone in the Vβ18 family is expressed. The prevalence of CD8+ oligoclonality in Vβ18 suggests the existence of a breast cancer LN-specific immune response, as Vβ18 is the only TCR Vβ gene family whose frequency of clonality is increased more in LNs than in PBMCs of breast cancer patients (Fig. 5).
Fig. 4
Fig. 4

Comparison of the oligoclonal frequency of CD8 + T cells in breast cancer and non-breast cancer patients

Frequency of oligoclonality is determined by comparing the number of samples containing a dominant band in each Vβ gene family with the total number of samples analyzed. (A) PBMC: blood sample; (B) LN: lymph node sample.

Fig. 5
Fig. 5

Comparison of the oligoclonal frequency in breast cancer patients’ LNs and PBMCs

Sequence Analysis of Vβ18 CD8+ T Cells of Breast Cancer Patients

To determine whether all dominant Vβ18 clones of breast cancer patients share a common sequence, DNA fragments were eluted out of the dominant bands and sequenced directly (Fig. 6). By using this method we obtained a single readable Vβ18 sequence from five Vβ18 bands of five LN samples (H.H., V.V., M.T., H.E., and J.W.), and two out of three dominant Vβ18 bands from three PBMC samples (M.T. and I.D.; see Table 3). No single readable sequence can be derived from dominant Vβ18 bands of patient P.V. and H.E. However, through sequencing the 10 aa-length Vβ18 band in the LN sample and the 9 aa-length Vβ18 band in the PBMC sample of patient P.V. by bacterial cloning, we obtained a dominant sequence that was found in over 50% of the clones. Again, no dominant Vβ18 sequence was found in LN CD8+ T cells of patient H.E. In patient M.T., the same Vβ18 clone appeared in both her blood and the LN, whereas in patient P.V., the Vβ18 clone in her LN is quite different from that in her peripheral blood. All together, six Vβ18 sequences were obtained from seven LNs of breast cancer patients, three of which use Jβ1.1. To determine whether Jβ1.1 is preferentially used in combination with the Vβ18 gene, we sequenced the Vβ18 TCR from LN CD8+ T cells of one non-breast cancer patient and two breast cancer patients who do not express dominant Vβ18 clones. Figure 7 shows that there is no obvious bias of Jβ1.1 usage by CD8+ Vβ18 cells of patients without dominant Vβ18 clones. The CDR3 sequence of the dominant Vβ18 clone isolated from one non-breast cancer LN does not use Jβ1.1. Whether the increased Jβ1.1 usage by Vβ18 clones in breast cancer patients is specific requires further studies with additional samples. Furthermore, examining CDR3-region sequences of all TCR Vβ18 clones of breast cancer patients did not reveal any identifiable motif.
Table 3

TCR Vβ18 sequences of CD8+ T cells of breast cancer patients

Patient (PBMC)

V β18

NDN

J

C

CDR3 length

H.H.

CASS

SRTSGGQG

DTQY FGPGTRLTVL (2.3)

ED

13 aaa

V.V.

CASS

PPGLSD

TEAF FGQGTRLTVV (1.1)

ED

11 aaa

M.T.

CASS

PSLGRD

EQY FGPGTRLTVT (2.7)

ED

10 aaa

P.V.

CASSP

PLGF

TEAF FGQGTRLTVV (1.1)

ED

10 aab

H.E.

CASSP

RGYYD

IQY FGAGTRLSVL (2.4)

ED

10 aaa

J.W.

CASS

VGEG

TEAF FGQGTRLTVT (1.1)

ED

9 aaa

I.D.

CASSP

WPSG

TQY FGPGTRLTVL (2.3)

ED

11 aaa

M.T.

CASS

PSLGRD

EQY FGPGTRLTVT (2.7)

ED

10 aaa

P.V.

CASSP

PAGT

EQF FGPGTRLTVL (2.1)

ED

9 aab

aSequence obtained by directly sequencing DNA fragments eluted from those domiant CDR3 bands on acrylamide gel.

bSequence obtained by bacterial cloning method. cDNA fragment for each TCR Vβ gene family was synthesized and cloned according to the procedures described in Materials and Methods. More than 20 clones were picked and sequenced. The sequence obtained from more than 50% of all clones was designated the dominant sequence.

Fig. 6
Fig. 6

CDR3 length distribution in V β 18 CD8 + T cells of breast cancer and non-breast cancer patients

CD8+ T cells were isolated either from lymph nodes (LN) or peripheral blood mononuclear cells (PBMC).

Fig. 7
Fig. 7

J β usage by V β 18 CD8 + T cells isolated from LNs of one non-breast cancer patient and two breast cancer patients who do not have dominant V β 18 clones

Sequence data were obtained from Table 3.

It is possible that all breast cancer patients expressing a dominant Vβ18 clone share the same HLA type, or they have a similar type of cancer. We therefore correlated HLA typing of eight breast cancer patients with the pathological findings of their tumors. In 4 patients who have dominant Vβ18 clones in their LN T cells, different HLA gene products were expressed (Table 4). Furthermore, all patients possessing Vβ18 clones in their LNs had an invasive tumor, and three had tumor-infiltrating LNs.
Table 4

TCR V β 18 clonality

Patients

 

Positive nodes

PBMC

J β

CDR3 length (aa)

LN

J β

J β

S.G.

Noninvasive

0

  

  

D.C.

Microinvasive

0

  

  

E.H.

Microinvasive

0

  

  

B.F.

Microinvasive

0

  

  

G.L.

Microinvasive

0

  

ND

  

D.M.

Invasive

0

  

  

M.B.

Invasive

0

ND

  

  

C.D.

Invasive

0

ND

  

  

J.K.

Invasive

0

ND

  

  

M.Z.

Invasive

0

  

ND

  

J.P.

Invasive

22/22

  

ND

  

M.T.

Invasive

0

+

2.7

10

   

I.L.

Invasive

0

ND

  

  

D.D.

Invasive

0

ND

  

  

V.V.

Invasive

0

ND

  

+

1.1

11

J.W.

Invasive

0

ND

  

+

1.1

9

I.D.

Invasive

6/19

+

2.3

11

ND

  

P.V.

Invasive

2/23

+

2.1

9

+

1.1

10

H.E.

Invasive

8/19

ND

  

+

2.4

10

H.H.

Invasive

23/39

ND

  

+

2.3

13

Discussion

Oligoclonality of CD8+ T cells has been observed in PBMCs of healthy individuals, and its frequency is increased in the aged population, in patients with autoimmune diseases, and in tumor-infiltrating lymphocytes (3437,44). Furthermore, viral infection or active immunization can induce the transient appearance of clonal expansion of CD8+ T cells (46). Although clonal expansion of CD8+ T cells has been documented by many investigators, the function of these clones has not been elucidated. Gregersen’s group has shown that the clonally expanded CD8+ cells are, in general, CD57+CD28 T cells (32). CD57 was first identified on natural killer (NK) cells, but it is also present on subsets of T cells (47). The function of CD57 is not known. This subpopulation expressing activation markers and a shorter telomeric length may represent chronically activated cells (32,48). Our report is the first to analyze and compare the oligoclonality of CD8+ T cells in the LNs and PBMCs of breast cancer patients and age-matched non-breast cancer controls. Our data show that the frequency of clonality is slightly higher in breast cancer patients, and there is an increased incidence of oligoclonal expansion of Vβ18 CD8+ T cells in breast cancer patients’ LNs.

Comparing PBMC samples from breast cancer patients and controls indicates that the number of TCR Vβ families expressing a dominant clone in breast cancer patients is slightly higher than that in non-breast cancer females, but there is no obvious prevalence of oligoclonal expansion in any Vβ gene family. Although the distribution pattern of clonality among different TCR Vβ families is similar between the two groups, there is a profound difference in the frequency of the Vβ18 gene family. Three out of 11 breast cancer patients, but none of the 16 control subjects, showed a dominant CD8+ T cell clone in the Vβ18 family. However, Monteiro et al. have previously analyzed 46 healthy controls with an average age of 32 (ages 14 to 57) and reported that the frequency of oligoclonality in Vβ18 was approximately 15% (44). Therefore, further analyses with additional age-matched female samples are required to determine whether the oligoclonal expansion in Vβ18 CD8+ T cells in breast cancer patients’ PBMCs is significant.

Analyzing the T cell oligoclonality in LNs of normal controls has generated two interesting observations. First, oligoclonality is clustered in a few Vβ families with a noticeable increase in the Vβ12 families. This biased distribution may be a result of a small sample pool (n = 9), and it may disappear upon increasing the sample size. However, it is possible that clonal expansion of Vβ12 CD8+ T cells is a result of chronic stimulation by LN-specific antigen(s). Since oligoclonality in LNs of healthy controls has not been previously examined and no information is available, we need to analyze additional samples to determine whether restricted oligoclonality in CD8+ T cells is an LN-specific phenomenon. Another interesting finding is that the CDR3 length distribution among Vβ gene families is quite different between the LN and PBMCs, even in the same patient (Fig. 2). This difference may be due to different homing properties among T cells, or to an active local immune response occurring at the LN which attracts a different subset of T cells. Furthermore, PBMCs have a higher frequency of oligoclonality than do LNs. It is possible that T cells in PBMC are coming from different tissues and lymphoid organs, and thus the T cell clonality displayed in PBMCs may represent a collective repertoire. However, studies on melanoma or glioma patients have shown that the oligoclonality of T cells at lesion sites is increased, compared with that in their PBMCs. TILs examined in these studies may have been obtained from late-stage tumors, and hence they may have been chronically stimulated by increasing numbers of tumor antigens, which may eventually lead to the generation of multiple clonal expansions. It is also plausible to speculate that breast cancer tumors possess fewer or a more restricted set of antigenic determinants than do other types of tumors. Nonetheless, to identify T cells important for or related to a specific local immune response, it is necessary to analyze T cells at the site of inflammation or at tumor infiltration sites.

In breast cancer LNs, the average number of TCR families displaying dominant CD8+ clones is slightly higher than that in non-breast cancer patients. Furthermore, there is an increased frequency of oligoclonality in the Vβ18 gene family whereas the frequency in the Vβ12 family is decreased, compared with that in non-breast cancer patients LNs. This phenomenon may reflect the existence of a new antigenic stimulation(s) in breast cancer patients’ LNs that preferentially activates Vβ18 T cells. The other piece of evidence suggesting that Vβ18 T cells may play a role in breast cancer in a specific immune response is our finding that Vβ18 is the only Vβ gene family with an increased frequency of clonality in the LN compared with the PBMC of breast cancer patients.

Because T cells recognize peptides presented together with MHC molecules, the same peptide-MHC complex is likely to activate T cells expressing restricted TCR Vβ gene products. Depending on the antigens, some responses can also be polyclonal. In the case of breast cancer, 6 out of 7 patients who have clonal expansion of CD8+ Vβ18 T cells in their PBMCs or LNs express different HLA haplotypes. A dominant Vβ usage by T cells among individuals expressing different MHC haplotypes is commonly seen in superantigen-mediated activation. However, superantigen stimulation generally leads to a polyclonal activation of T cells expressing a specific Vβ gene. Therefore, it is unlikely that the clonal expansion of Vβ18 T cells is a result of conventional super-antigen stimulation. The prevalence of clonal expansion of Vβ18 T cells in breast cancer may resemble a previous study performed by Boitel et al., who demonstrated that the Tetanus Toxoid (TT)-specific CD4+ T cells isolated from TT-immunized individuals preferentially express Vβ2 gene, regardless of the HLA type (49). It is possible that genomic-encoded Vβ18 gene sequences in the CDR3 region interact with a common structural determinant formed by the antigen and different HLA molecules. On the other hand, the CDR3-region sequence of all our Vβ18 T cell clones is quite heterogenous. This finding suggests that the junctional region may either interact with a polymorphic determinant on the HLA-peptide complex, or it may not play a major role in the recognition of HLA-peptide complex and therefore, may not be structurally conserved. Another possibility is that a common motif is formed by a combination sequence derived from CDR3 regions of both Vβ and Vα chains. Presently, we are analyzing the Vα gene of these dominant Vβ18 clones to determine whether there is a biased Vα usage.

Declarations

Acknowledgments

The authors thank Drs. B. Diamond, S. Macphail, and P. Gregersen for their critical review of this manuscript, and H. Y. Son, V. Gross, and R. Kadar for technical assistance. This work was supported by NIH grant GM 45919 (to M-d.Y.C). M-d. Y. Chang is a recipient of the Junior Faculty Award of American Cancer Society.

Authors’ Affiliations

(1)
Department of Medicine, North Shore University Hospital-New York University Medical College, 350 Community Dr., Manhasset, New York 11030, USA
(2)
Department of Pathology, North Shore University Hospital-New York University Medical College, Manhasset, New York, USA
(3)
Department of Surgery, North Shore University Hospital-New York University Medical College, Manhasset, New York, USA
(4)
Department of Research, North Shore University Hospital-New York University Medical College, Manhasset, New York, USA

References

  1. Ioannides CG, Whiteside TL. (1993) T cell recognition of human tumors: implications for molecular immunotherapy of cancer. Clin. Immunol Immunopathol. 66: 91–106.View ArticlePubMedGoogle Scholar
  2. Cardi G, Mastrangelo MJ, Berd D. (1989) Depletion of T-cells with the CD4+CD45R+ phenotype in lymphocytes that infiltrate subcutaneous metastases of human melanoma. Cancer Res. 49: 6562–6565.PubMedGoogle Scholar
  3. Shimizu Y, Weidmann E, Iwatsuki S, Herberman RB, Whiteside TL. (1991) Characterization of human autotumor-reactive T-cell clones obtained from tumor-infiltrating lymphocytes in liver metastasis of gastric carcinoma. Cancer Res. 51: 6153.PubMedGoogle Scholar
  4. Haskill S. (1982) Some historical perspectives on the relationship between survival and mononuclear cell infiltration. In: Haskill S (ed). Tumor Immunity and Prognosis: The Role of Mononuclear Cell Infiltration. Marcel Dekker, New York, pp. 1–10.Google Scholar
  5. Brocker EB, Kolde G, Steinhausen D, Peters A, Macher E. (1992) The pattern of the mononuclear infiltrate as a prognostic parameter in flat superficial spreading melanomas. J. Cancer Res. Clin. Oncol. 107: 48–52.View ArticleGoogle Scholar
  6. Kawakami Y, Eliyahu S, Jennings C, Sakaguchi K, Kang X, Southwood S, Robbins PF, Sette A, Appella E, Rosenberg SA. (1995) Recognition of multiple epitopes in human melanoma antigen gp100 by tumor-infiltrating T lymphocytes associated with in vivo tumor regression. J. Immunol. 154: 3961–3968.PubMedGoogle Scholar
  7. Mandelboim O, Berke G, Fridkin M, Feldman M, Elsenstein M, Eisenbach L. (1994) CTL induction by a tumour-associated antigen octapeptide derived from a murine lung carcinoma. Nature 369: 67–71.View ArticlePubMedGoogle Scholar
  8. Yoshino I, Goedegebuure PS, Peoples GE, Lee K-Y, Eberlein TJ. (1994) Human tumorinfiltrating CD4+ T cells react to B cell lines expressing heat shock protein 70. J. Immunol 153: 4149–4158.PubMedGoogle Scholar
  9. Monach PA, Meredith SC, Siegel CT, Schreiber H. (1995) A unique tumor antigen produced by a single amino acid substitution. Immunity 2: 45–59.View ArticlePubMedGoogle Scholar
  10. Visseren MJW, Elsas AV, van der Voort EI, Ressing ME, Kast WM, Schrier PI, Melief CJM. (1995) CTL specific for the tyrosinase autoantigen can be induced from healthy donor blood to lyse melanoma cells. J. Immunol. 154: 3991–3998.PubMedGoogle Scholar
  11. Peoples GE, Oedegebuure PS, Andrews JVR, Schoof DD, Eberlein TJ. (1993) HLA-A2 presents shared tumor-associated antigen derived from endogenous proteins in ovarian cancer. J. Immunol. 151: 5481–5491.PubMedGoogle Scholar
  12. Robbins PF, El-Gamil M, Li Y, Topalian SL, Rivoltini L, Sakaguchi K, Appella E, Kawakami Y, Rosenberg SA. (1995) Cloning of a new gene encoding an antigen recognized by melanoma-specific HLA-A24-restricted tumor-infiltrating lymphocytes. J. Immunol. 154: 5944–5950.PubMedGoogle Scholar
  13. Menoret A, Patry Y, Burg C, Pendu JL. (1995) Co-segregation of tumor immunogenicity with expression of inducible but not costitutive hsp70 in colon carcinomas. J. Immunol. 155: 740–747.PubMedGoogle Scholar
  14. Whiteside TL. (1992) Tumor-infiltrating lymphocytes as antitumor effector cells. Biotherapy 5: 47–61.View ArticlePubMedGoogle Scholar
  15. Ioannides CG, Freedman RS. (1991) Selective usage of TCR Vβ in tumor specific CTL lines isolated from ovarian tumor associated lymphocytes. Anticancer Rev. 11: 1919–1925.Google Scholar
  16. Ferradini L, Roman-Roman S, Azocar J, Avril M-F, Viel S, Triebel F, Hercend T. (1992) Analysis of T-cell receptor α/β variability in lymphocytes infiltrating a melanoma metastasis. Cancer Res. 52: 4649–4654.PubMedGoogle Scholar
  17. Albertini MR, Nicklas JA, Chastenay BF, Hunter TC, Albertini RJ, Clark SS, Hank JA, Sondel PM. (1991) Analysis of T cell receptor β and α genes from peripheral blood, regional lymph node and tumor-infiltrating lymphocyte clones from melanoma patients. Cancer Immunol. Immunother. 32: 325–330.View ArticlePubMedGoogle Scholar
  18. Sensi M, Salvi S, Castelli C, Maccalli C, Mazzocchi A, Mortarini R, Nicolini G, Herlyn M, Parmiani G, Anichini A. (1993) T cell receptor (TCR) structure of autologous melanoma-ractive cytotoxic T lymphocyte (CTL) clones: Tumor-infiltrating lymphocytes overexpress in vivo the TCRβ chain sequence used by an HLA-A2-restricted and melanocyte-lineage-specific CTL clone. J. Exp. Med. 178: 1231–1246.View ArticlePubMedGoogle Scholar
  19. Nitta T, Oksenberg JR, Rao NA, Steinman L. (1990) Predominant expression of T cell receptor Vα7 in tumor-infiltrating lymphocytes of Uveal melanoma. Science 24: 672–674.View ArticleGoogle Scholar
  20. Jerome KR, Domenech N, Finn OJ. (1993) Tumor-specific cytotoxic T cell clones from patients with breast and pancreatic adenocarcinoma recognize EBV-immortalized B cells transfected with polymorphic epithelial mucin complementary DNA. J. Immunol. 151: 1654–1662.PubMedGoogle Scholar
  21. Barth RJ, Mule JJ, Spiess PJ, Rosenberg SA. (1991) Interferon γ and tumor necrosis factor have a role in tumor regressions mediated by murine CD8+ tumor infiltrating lymphocytes. J. Exp. Med. 173: 647–658.View ArticlePubMedGoogle Scholar
  22. Schwartzentruber DJ, Topalian SL, Mancini M, Rosenberg SA. (1991) Specific release of granulocyte-macrophage colony-stimulating factor, tumor necrosis factor-α, and IFN-γ by human tumor-infiltrating lymphocytes after autologous tumor stimulation. J. Immunol. 146: 3674–3681.PubMedGoogle Scholar
  23. Schwartzentruber DJ, Solomon D, Rosenberg SA, Topalian SL. (1992) Characterization of lymphocytes infiltrating human breast cancer: Specific immune reactivity detected by measuring cytokine secretion. J. Immunother. 12: 1–12.View ArticlePubMedGoogle Scholar
  24. Takagi S, Chen K, Schwarz R, Iwatsuki S, Herberman RB, Whiteside TL. (1989) Functional and phenotypic analysis of tumor-infiltrating lymphocytes isolated from human primary and metastatic liver tumors and cultured in recombinant IL-2. Cancer 63: 102–111.View ArticlePubMedGoogle Scholar
  25. Belldegrun A, Kasid A, Uppenkamp M, Topalian SL, Rosenberg SA. (1989) Human tumor infiltrating lymphocytes: Analysis of lymphokine mRNA expression relevance to cancer immunotherapy. J. Immunol. 42: 4520–4526.Google Scholar
  26. Wilson RK, Lai E, Concannon P, Barth RK, Hood LE. (1988) Structure, organization and polymorphism of murine and human T cell receptor α and β chain gene families. Immunol. Rev. 101: 149–172.View ArticlePubMedGoogle Scholar
  27. Roman-Roman S, Ferradini L, Azocar J, Genevee C, Hercend T, Triebel F. (1991) Studies on the human T cell receptor α/β variable genes. Identification of 7 additional Vα subfamilles and 14 Jα gene segments. Eur. J. Immunol. 21: 927–933.View ArticlePubMedGoogle Scholar
  28. Ferradini L, Roman-Roman S, Azocar J, Michalaki H, Triebel F, Hercend T. (1991) Studies on human T cell receptor α/β variable region genes. II. Identification of four additional Vβ subfamilies. Eur. J. Immunol. 21: 935–942.View ArticlePubMedGoogle Scholar
  29. Mathoulin M-P, Xerri L, Jcquemier J, Adelaide J, Parc P, Hassoun J. (1993) Unrestricted T-cell receptor V-region gene repertoire in tumor-infiltrating lymphocytes from human breast carcinomas. Cancer 72: 506–510.View ArticlePubMedGoogle Scholar
  30. Jorgensen JL, Esser U, de St. Fazakas Groth B, Reay PA, Davis MM. (1992) Mapping T cell receptor peptide contacts by variant peptide immunization of single chain tansgenic. Nature 355: 224–230.View ArticlePubMedGoogle Scholar
  31. Panneitier C, Even J, Kourilsky P. (1995) T-cell repertoire diversity and clonal expansion in normal and clinical samples. Immunol. Today 16: 176–181.View ArticleGoogle Scholar
  32. Morley JK, Batliwalla FM, Hingorani R, Gregersen PK. (1995) Oligoclonal CD8+ T cells are preferentially expanded in the CD57+ subset. J. Immunol. 154: 6182–6190.PubMedPubMed CentralGoogle Scholar
  33. Hingorani R, Choi I-H, Akolkar P, Gulwani-Akolkar B, Pergolizzi R, Silver J, Gregersen PK. (1993) Clonal predominance of T cell receptors within CD8+ CD45RO+ subset in normal human subjects. J. Immunol. 151: 5762–5769.PubMedGoogle Scholar
  34. Ebato M, Nitta T, Yagita H, Sato K, Okumura K. (1994) Shared amino acid sequences in the NDβN and Nα regions of the T cell receptors of tumor-infiltrating lymphocytes within malignant glioma. Eur. J. Immunol. 24: 2987–2992.View ArticlePubMedGoogle Scholar
  35. Yamamoto K, Masuko K, Takahashi S, Ikeda Y, Kato T, Mizushima Y, Hayashi K, Nishioka K. (1994) Accumulation of distinct T cell clonotypes in human solid tumors. J. Immunol. 154: 1804–1809.Google Scholar
  36. Farace F, Orlanducci F, Dietrich P-Y, Gaudin C, Angevin E, Courtier M-H, Bayle C, Hercend T, Triebel F. (1995) T cell repertoire in patients with B chronic lymphocytic leukemia. J. Immunol. 153: 4281–4290.Google Scholar
  37. Puisieux I, Even J, Panneeitier C, Jotereau F, Favrot M, Kourilsky P. (1994) Oligoclonality of tumor-infiltrating lymphocytes from human melanomas. J. Immunol. 153: 2807–2818.PubMedPubMed CentralGoogle Scholar
  38. Jerome KR, Barnd DL, Bendt KM, Boyer CM, Taylor-Papadimitriou J, McKenzie IFC, Bast RC, Finn OJ. (1991) Cytotoxic T-lymphocytes derived from patients with breast adenocarcinoma recognize an epitope present on the protein core of a mucin molecule preferentially expressed by malignant cells. Cancer Res. 51: 2908–2916.PubMedGoogle Scholar
  39. Barnd DL, Lan MS, Metzgar RS, Finn OJ. (1989) Specific major histocompatibility complex-unrestricted recognition of tumor-associated mucins by human cytotoxic T cells. Proc. Natl. Acad. Sci. U.S.A. 86: 7159–7163.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Peoples E, Geodegebuur PS, Smith R, Linhan DC, Yoshino I, Eberlein TJ. (1995) Breast and ovarian cancer-specific cytotoxic T lymphocytes rcognize the same HER-2/neu derived peptide. Proc. Natl. Acad. Sci. U.S.A. 92: 432–436.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Fishleder AJ, Finke JH, Tubbs R, Bukowski RM. (1990) Induction by interleukin-2 of oligoclonal expansion of cultured tumor-infiltration lymphcyte. J. Natl. Cancer Inst. 82: 124–128.View ArticlePubMedGoogle Scholar
  42. Bennet WT, Pandolfi F, Grove BH, Hawes GE, Boyl LA, Kradin RL, Kurnick JT. (1992) Dominant rearrangements among human tumor-infiltrating lymphocytes. Cancer 9: 2379–2384.View ArticleGoogle Scholar
  43. Ioannides CG, Platsoucas CD, Rashed S, Wharton JT, Edwards CL, Freedman RS. (1991) Tumor cytolysis by lymphocytes infiltrating ovarian malignant ascites. Cancer Res. 51: 4257–4265.PubMedGoogle Scholar
  44. Monteiro J, Hingorani R, Choi I-H, Silver J, Pergolizzi R, Gregersen PK. (1995) Oligoclonality in the human CD8+ T cell repertoire in normal subjects and monozygotic twins: Implications for studies of infectious and autoimmune diseases. Mol. Med. 1: 614–624.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Batliwalla F, Monteiro J, Serrano D, Gregersen PK. (1996) Oligoclonality of CD8+ T cells in health and disease: Aging, infection, or immune regulation? Hum. Immunol. 48: 68–76.View ArticlePubMedGoogle Scholar
  46. Wang ECY, Moss PAH, Frodsham P, Lehner PJ, Bell JI, Borysiewicz LK. (1995) CD8high CD57+ T lymphocytes in normal, healthy individuals are oligoclonal and respond to human cytomegalovirus. J. Immunol. 155: 5046–5056.PubMedGoogle Scholar
  47. Schubert J, Lanier L, Schmidt RE. (1989) Cluster report: CD57. In: Knapp W, Dorken B, Gilks WR, Rieber P, Schmidt RE, Stien H, Kr. von dem Borne AEG (eds). Leukocyte Typing IV: White Cell Differentiation Antigens. Oxford University Press, New York.Google Scholar
  48. Monteiro J, Batliwalla F, Ostrer H, Gregersen PK. (1996) Shortened telomeres in clonally Expanded CD28-CD8+ T cells imply a relicative history that is distinct from their CD28+CD8+ counterparts. J. Immunol. 156: 3587–3590.PubMedGoogle Scholar
  49. Boitel B, Ermonval M, Panina-Bordignon P, Mariuzza RA, Lanzavecchia A, Acuto O. (1992) Preferential Vβ gene usage and lack of junctional sequnce connservation among human T cell receptors specific for a dominant role of a germline-encoded V region in antigen/major histocompatibility complex recognition. J. Exp. Med. 175: 765–777.View ArticlePubMedGoogle Scholar

Copyright

© Picower Institute Press 1997

Advertisement