Skip to main content

Table 1 The sequences of the different ins-PRS probes used and comparison to the TH 3′-UTR. Ins-PRS, insulin pyrimidine-rich sequence; TH HIPBS, tyrosine hydroxylase hypoxia inducible protein binding sequence. The core binding sequences for respective mRNA are marked in bold and mutated nucleotides are underlined.

From: Hypoxia May Increase Rat Insulin mRNA Levels by Promoting Binding of the Polypyrimidine Tract-binding Protein (PTB) to the Pyrimidine-rich Insulin mRNA 3′-Untranslated Region

mRNA probe Sequence
TH HIPBS 5′CUUUCCCAAAGUCUCCAUCCCCUUCUCCAACCUUUCCUa
Ins-PRS wild-type 5′UCCACCACUCCCCGCCCACCCCUCUb
Ins-PRS mutant 1 5′UCCACCACUCCCCGCCCACCACUCU
Ins-PRS mutant 2 5′UCCACCACUCCCCUCCCACCCCUCU
  1. aFrom Gene Bank accession number M10244, 5′ is at position 1540, HIPBS is located between 1552 and 1579 (46).
  2. bFrom Gene Bank accession number J00747, 5′ is at position 4516.