Skip to main content

Table 1 RT-qPCR primer sequences

From: Protective role of down-regulated microRNA-31 on intestinal barrier dysfunction through inhibition of NF-κB/HIF-1α pathway by binding to HMOX1 in rats with sepsis

mRNA Forward primers (5′-3′) Reverse primers (5′-3′)
miR-31 CAGCTATGCCAGCATCTTGCCT ATATGGAACGCTTCACGAATT
NF-κB GGGCATGGGAATTTCCAACTC GCAGAAGTAACTTTCCGAGAGG
IκB TTGCTGAGGCACTTCTGAAAG TCTGCGTCAAGACTGCTACAC
HIF-1α GTCGGACAGCCTCACCAAACAG TAGGTAGTGAGCCACCAGTGTCC
HMOX-1 CTCAAACCTCCAAAAGCC TCAAAAACCACCCCAACCC
ZO-1 CCATTCTTTGGACCGATTGCTG TAATGCCCGAGCTCCGATG
Occludin ACGGTGCCATAGAATGAGATGTTG CAGCTAGTTGTTCATTTCTGCACCA
GADPH TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
  1. Note: RT-qPCR Reverse transcription quantitative polymerase chain reaction, miR-31 microRNA-31, NF-κB nuclear factor-kappa B, IκB inhibitor of NF-κB, HIF-1α hypoxia inducible factor-1α, HMOX-1 heme oxygenase 1, ZO-1 zonula occludens-1, GADPH glyceraldehyde-3-phosphate dehydrogenase