Skip to main content

Advertisement

Table 1 Primer sequences of RT-qPCR

From: Suppressed microRNA-96 inhibits iNOS expression and dopaminergic neuron apoptosis through inactivating the MAPK signaling pathway by targeting CACNG5 in mice with Parkinson’s disease

Gene Primer sequence (5’ - 3’)
miR-96 Forward: CGGCGGTTTGGCAATGGTAGAACT
Reverse: CCAGTGCAGGGTCCGAGGTAT
CACNG5 Forward: GCGATTAGAGCCCAGCATGA
Reverse: TGTCTTCAGGGGAGCACTTTC
p38MAPK Forward: TCGAGACCGTTTCAGTCCAT
Reverse: CCACGGACCAAATATCCACT
c-Fos Forward: GGCTCTCCTGTCAACACACA
Reverse: CCGCTTGGAGTGTATCTGTC
iNOS Forward: ATGGACCAGTATAAGGCAAGC
Reverse: GCTCTGGATGAGCCTATATTG
Bax Forward: TGGAGCTGCAGAGGATGATTG
Reverse: GCTGCCACTCGGAAAAAGAC
Bcl-2 Forward: TGCACCTGAGCGCCTTCAC
Reverse: TAGCTGATTCGACCATTTGCCTGA
U6 Forward: GTGCTCGCTTCGGCAGCACAT
Reverse: ATATGGAACGCTTCACGAAT
GAPDH Forward: CCCATCACCATCTTCCAGGAG
Reverse: CTTCTCCATGGTGGTGAAGACG
  1. Note: RT-qPCR Reverse transcription quantitative polymerase chain reaction, miR-96 microRNA-96, CACNG5 Calcium voltage-gated channel auxiliary subunit gamma 5, p38MAPK p38 mitogen-activated protein kinase, iNOS Inducible nitric oxide synthase, Bcl-2 B-cell lymphoma-2, Bax Bcl-2 associated protein X, GAPDH Glyceraldehyde-3-phosphate dehydrogenase