Skip to main content

Table 1 Mouse primers

From: Loss of intestinal sympathetic innervation elicits an innate immune driven colitis

Gene Forward sequence Reverse sequence
IL-1β GCCCATCCTCTGTGACTCAT AGGCCACAGGTATTTTGTCG
IL-6 GAGTTGTGCAATGGCAATTCTG TGGTAGCATCCATCATTTCTTTGT
IL-10 TGTCAAATTCATTCATGGCCT ATCGATTTCTCCCCTGTGAA
IL-12 AGACCCTGCCCATTGAACTG CGGGTCTGGTTTGATGATGTC
TNF-α TGGAACTGGCAGAAGAGGCACT CCATAGAACTGATGAGAGGGAGGC
Nos2 TTCTGTGCTGTCCCAGTGAG TGAAGAAAACCCCTTGTGCT
Arg1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC
IL-22 CGGCTCATCGGGGAGAAAC TGACTGGGGGAGCAGAACG
Reg3γ TCCACCTCTGTTGGGTTCAT AAGCTTCCTTCCTGTCCTCC
DefA CGCAGCCATGAAGAAACTTG GAATCAGCCTGGACCTGGAA
Muc2 TGAAGACCGAGATTGTGCCC AGATGACGTTGAGCTGGGTG
β-actin TTCTTTGCAGCTCCTTCGTT ATGGAGGGGAATACAGCCC
Ubiquitin AGCCCAGTGTTACCACCAAG ACCCAAGAACAAGCACAAGG
HPRT CCTAAGATGAGCGCAAGTTGAA CCACAGGACTAGAACACCTGCTAA
Cyclophilin ATGGTCAACCCCACCGTGT TTCTGCTGTCTTTGGAACTTTGTC
GAPDH ATGTGTCCGTCGTGGATCTGA ATGCCTGCTTCACCACCTTCT
RPLP0 CCAGCGAGGCCACACTGCTG ACACTGGCCACGTTGCGGAC