Skip to main content

Table 1 Primer sequence for RT-qPCR

From: Silencing of SAA1 inhibits palmitate- or high-fat diet induced insulin resistance through suppression of the NF-κB pathway

Gene Forward (5′-3′) Reverse (5′-3′)
SAA1 (human) CCAATCTCCGACCTGCTG GCTTTGTATCCCTGCCCTGAG
Saa1 (mouse) GGACTGCCTGACAAATACTGAG GAGCATCTTCAGTGTTCCTAGG
IRS1 (human) AGGATATTTAATTTGCCTCGG AAGCGTTTGTGCATGCTCTTG
SOCS3 (human) CCACTCTTCAGCATCTCTGT ACTGAACCTGACCGTACAATCGTACTGGTCCAGGAACT
β-actin (human) GCAAAGACCTGTACGCCAACA TGCATCCTGTCGGCAATG
β-actin (mouse) GACATGGAGAAGATCTGG CTTTACGGATGACAACG
  1. Notes: RT-qPCR reverse transcription quantitative polymerase chain reaction, Saa1 serum amyloid A protein 1, IRS1 insulin receptor substrate 1, SOCS3 suppressor of cytokine signaling 3