Skip to main content

Table 1 Primers used for qRT-PCR analysis

From: miR-122 promotes hepatic lipogenesis via inhibiting the LKB1/AMPK pathway by targeting Sirt1 in non-alcoholic fatty liver disease

Genes Primer sequences (5′-3′)
hsa(mmu)-miR-122 F: 5′-AGCGTGGAGTGTGACAATGG-3’
  R: 5′-GTCGTATCCAGTGCAGGGTCCGAG
GTATTCGCACTGGATACGACCAAACA-3’
hsa(mmu)-U6 F: 5′-CTCGCTTCGGCAGCACA-3’
  R: 5′-AACGCTTCACGAATTTGCGT-3’
hSirt1 F: 5′-TGCCGGAAACAATACCTCCA-3’
  R: 5′-AGACACCCCAGCTCCAGTTA-3’
hSREBP1 F: 5′-GGAGCCATGGATTGCACTTTCG-3’
  R: 5′-GCTCAGGAAGGCTTCAAGAGAG-3’
hFASN F: 5′-TATGAAGCCATCGTGGACGG-3’
  R: 5′-GAAGAAGGAGAGCCGGTTGG-3’
hSCD1 F: 5′-CTTGCGATATGCTGTGGTGC-3’
  R: 5′-AAGTTGATGTGCCAGCGGTA-3’
hACC1 F: 5′-CAAGGTCAGCTGGTCCACATG-3’
  R: 5′-GTGGAATACCTTCTGCCCTAGC-3’
hApoA5 F: 5′- GACCAGGAGACTGAGGAGGT-3’
  R: 5′-TTGCTCAGAACCTTGCCACT-3’
hβ-actin F: 5′- CCTCGCCTTTGCCGATCC-3’
  R: 5′- GGATCTTCATGAGGTAGTCAGTC − 3’
mSirt1 F: 5′-GACGCTGTGGCAGATTGTTA-3’
  R: 5′-GGAATCCCACAGGAGACAGA-3’
mSREBP1 F: 5′-CCACAATGCCATTGAGAAGCG-3’
  R: 5′-CTGACACCAGGTCCTTCAGTG-3’
mFASN F: 5′-TTGCTGGCACTACAGAATGC-3’
  R: 5′-AACAGCCTCAGAGCGACAAT-3’
mSCD1 F: 5′-CACACCTTCCCCTTCGACTA-3’
  R: 5′-TGACTCCCGTCTCCAGTTCT-3’
mACC1 F: 5′-CTTGGAGCAGAGAACCTTCG-3’
  R: 5′-ACTTCCCGACCAAGGACTTT-3’
mApoA5 F: 5′-AGAAGCTGGCACAGGAGAAC-3’
  R: 5′-AGCTGAGCCTTGGTGTCTTC-3’
mβ-actin F: 5′-GTCGTACCACAGGCATTGTGATGG-3’
  R: 5′-GCAATGCCTGGGTACATGGTGG-3’
  1. Note: The primers were manufactured by Nanjing Genescript Co. Ltd. (Nanjing, P.R China)