Skip to main content

Table 1 All primers for reverse transcription-quantitative polymerase chain reaction

From: Melatonin prevents bone destruction in mice with retinoic acid–induced osteoporosis

Gene Primer sequence(5′-3′)
Gapdh Forward:AGGTCGGTGTGAACGGATTTG;
Reverse: TGTAGACCATGTAGTTGAGGTCA;
Tnfrsf11a Forward: GGACGGTGTTGCAGCAGAT;
Reverse: GCAGTCTGAGTTCCAGTGGTA;
Ctsk Forward: GAAGAAGACTCACCAGAAGCAG;
Reverse: TCCAGGTTATGGGCAGAGATT;
Calcr Forward:CAAACCGAAGATGAGGTTCCTT;
Reverse:TGGGCTCACTAGGAGCAGG;
Ocn Forward: CTGACCTCACAGATCCCAAGC;
Reverse:TGGTCTGATAGCTCGTCACAAG;
Opn Forward: ACCCAGAAACTGGTCATCAGC;
Reverse:CTGCAATACACACACTCATCACT;
Runx2 Forward:ATGCTTCATTCGCCTCACAAA;
Reverse:GCACTCACTGACTCGGTTGG;
Nox1 Forward: TCTCCAGCCTATCTCATCCTGA;
Reverse: GCTGCATACATCACTGTCATGTT;
Nox2 Forward: TGTGGTTGGGGCTGAATGTC;
Reverse: CTGAGAAAGGAGAGCAGATTTCG;
Sod1 Forward:AACCAGTTGTGTTGTCAGGAC;
Reverse:CCACCATGTTTCTTAGAGTGAGG;
Sod2 Forward: CAGACCTGCCTTACGACTATGG;
Reverse: CTCGGTGGCGTTGAGATTGTT;
  1. Tnfrsf11a Tumor necrosis factor receptor superfamily member 11a, Ctsk Cathepsin K, Calcr Calcitonin receptor, Ocn Osteocalcin, Opn Osteopontin, Runx2 Runt-related transcription factor-2, Nox1 NADPH oxidase 1, Nox2 NADPH oxidase 2, Sod1 Cu/Zn superoxide dismutase, Sod2 Manganese superoxide dismutase