Skip to main content

Table 2 The primers were used in this study

From: Long non-coding RNA MCM3AP-AS1 promotes growth and migration through modulating FOXK1 by sponging miR-138-5p in pancreatic cancer

NameSequence (5′-3′)
MCM3AP-AS1F: GCTGCTAATGGCAACACTGA
R: AGGTGCTGTCTGGTGGAGAT
miR-138-5pF: AGCTGGTGTTGTGAATCAGGCCG
R: AACGCTTCACGAATTTGCGT
FOXK1F: GCCTCCTTGACAATACCGCT
R: TTCCAAACCCTCCCTCTGGT
GAPDHF: CAGGAGGCATTGCTGATGAT
R: GAAGGCTGGGGCTCATTT
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT