Skip to main content

Table 1 The qRT-PCR primer sequences

From: Edaravone reduces oxidative stress and intestinal cell apoptosis after burn through up-regulating miR-320 expression

NameForward primer: 5′-3’Reverse primer: 5′-3’
miR-320AAAAGCTGGGTTGAGAGGGTGCGTGTCGTGGAGTC