Skip to main content

Table 1 Primers for real-time RT-PCR

From: The protective effects of the β3 adrenergic receptor agonist BRL37344 against liver steatosis and inflammation in a rat model of high-fat diet-induced nonalcoholic fatty liver disease (NAFLD)

Gene namePrimer Sequence (5′ → 3′)
β3-ARForward: GTGTCCTTTGCGCCCATC
Reverse: GCGCTTAGCTACGACGAACA
PPAR-αForward: CGCTGGGTCCTCTGGTTGTC
Reverse: TTCAGTCTTGGCTCGCCTCT
PPAR-γForward: TTCGCTGATGCACTGCCTAT
Reverse: GTCAGCTCTTGTGAACGGGA
CD36Forward: GGAACTGTGGGCTCATTACTGG
Reverse: GACAACTTCCCTTTTGATTGTCTTCT
mCPT-1Forward: GGAGAGTGCCAGGAGGTCATAG
Reverse: TGTCCTTTGTAATGTGCGAGCTG
GAPDHForward: CCTCTGACTTCAACAGCGACAC
Reverse: TGGTCCAGGGGTCTTACTCC
  1. β3-AR beta-3 adrenergic receptor, PPAR-ɑ peroxisome proliferator-activated receptor-alpha, PPAR-γ peroxisome proliferator-activated receptor-gamma, mCPT-1 mitochondria carnitine palmitoyltransferase-1, GAPDH glyceraldehyde-3-phosphate dehydrogenase