Skip to main content

Table 1 Oligonucleotide primer sets for real-time PCR

From: Electroacupuncture alleviates polycystic ovary syndrome-like symptoms through improving insulin resistance, mitochondrial dysfunction, and endoplasmic reticulum stress via enhancing autophagy in rats

Name Sequence (5′¬3′) Length
CYP17 F TGGAGGTGATAAAGGGTT 18
CYP17 R CGTCAGGCTGGAGATAGA 18
CYP19 F GCCTGTCGTGGACTTGGT 18
CYP19 R TAAATTCATTGGGCTTGG 18
PPARγ F TACCACGGTTGATTTCTC 18
PPARγ R AATAATAAGGCGGGGACG 18
PGC-1α F GAACAAGACTATTGAGCGAACC 22
PGC-1α R GAGTGGCTGCCTTGGGTA 18
β-actin F CCACTGCCGCATCCTCTT 18
β-actin R GGTCTTTACGGATGTCAACG 20