Skip to main content

Table 1 Mouse primer sequences for the real-time PCR

From: Fibroblast growth factor-2 alleviates the capillary leakage and inflammation in sepsis

Gene Forward primer Reverse primer
GAPDH GCACAGTCAAGGCCGAGAAT GCCTTCTCCATGGTGGTGAA
IL-1β TGCCACCTTTTGACAGTGATG TTCTTGTGACCCTGAGCGAC
IL-6 GCCTTCTTGGGACTGATGCT TGTGACTCCAGCTTATCTCTTGG
IL-10 TAAGGCTGGCCACACTTGAG GTTTTCAGGGATGAAGCGGC
TNF-α ACCCTCACACTCACAAACCA ACCCTGAGCCATAATCCCCT
CXCL1 GGATGCCACAGGATTCCATA GTGCCATCAGAGCAGTCTGT
CXCL10 CCAAGTGCTGCCGCTCATTTTC TCCCTATGGCCCTCATTCTCA
MCP-1 TAAAAACCTGGATCGGAACCAAA GCATTAGCTTCAGATTTACGGGT
TLR4 TGCAAGGAGGTTCAGTGCTC AGTGAATGAGCCCCAGCAAA
ICAM1 TTCTCATGCCGCACAGAACT TCCTGGCCTCGGAGACATTA