Skip to main content

Table 2 Human primer sequences for the real-time PCR

From: Fibroblast growth factor-2 alleviates the capillary leakage and inflammation in sepsis

Gene Forward primer Reverse primer
GAPDH GGAGTCCACTGGCGTCTTC GGTTCACACCCATGACGAAC
IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA
IL-6 ACCCCCAATAAATATAGGACTGGA AGAAGGCAACTGGACCGAAG
IL-10 TACGGCGCTGTCATCGATTT TAGAGTCGCCACCCTGATGT
TNF-α TGGGATCATTGCCCTGTGAG GGTGTCTGAAGGAGGGGGTA
CXCL1 GCAGGGAATTCACCCCAAGA GGTAGCCCTTGTTTCCCCC
CXCL10 AGCAGAGGAACCTCCAGTCT ATGCAGGTACAGCGTACAGT
MCP-1 TTCCCCTAGCTTTCCCCAGA TCCCAGGGGTAGAACTGTGG