Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Silencing long non-coding RNA XIST suppresses drug resistance in acute myeloid leukemia through down-regulation of MYC by elevating microRNA-29a expression

Targeted genes Forward sequence (5′–3′) Reverse sequence (5–3′)
XIST TCCTTTTCTGGCATCAGCGTT GGCATCACCTCCTGGTTGAAT
miR-29a TGCGCTAGCACCATCTGAAAT CAGTGCAGGGTCCGAGGT
MYC GGCTCCTGGCAAAAGGTCA CTGCGTAGTTGTGCTGATGT
MRP1 TTCCGGAACTACTGCCTGCGCTA GGGTCCTGGGGGATGATGGTG
P-GP CCCATCATTGCAATAGCAGG GTTCAAACTTCTGCTCCTGA
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
  1. RT-qPCR, reverse transcription quantitative polymerase chain reaction; MRP1, multidrug resistance-associated protein 1, P-gp, P-glycoprotein; Bcl-2, B-cell leukemia/lymphoma 2, GAPDH, glyceraldehyde-3-phosphate dehydrogenase