Skip to main content

Table 2. Primers

From: Circulating Tfh cell and subsets distribution are associated with low‐responsiveness to hepatitis B vaccination

Gene Primer sequence (5′ - 3′)
GAPDH
 Forward GGACCTGACCTGCCGTCTAG
 Reverse GTAGCCCAGGATGCCCTTGA
Pten
 Forward CACCAGTTCGTCCCTTTCCAG
 Reverse AAGACCATAACCCACCACAGC
BCL6
 Forward TTCCGCTACAAGGGCAAC
 Reverse TGCAACGATAGGGTTTCTCA
HsnRNA U6 primer HmiRQP9001 (GeneCopoeia)
hsa-miR-155-5p HmiRQP0221 (GeneCopoeia)
hsa-miR-146a-5p HmiRQP0196 (GeneCopoeia)
hsa-miR-17-5p HmiRQP0230 (GeneCopoeia)
hsa-miR-18a-5p HmiRQP0255 (GeneCopoeia)
hsa-miR-19a-3p HmiRQP0293 (GeneCopoeia)
hsa-miR-19b-1-5p HmiRQP0294 (GeneCopoeia)
hsa-miR-20a-5p HmiRQP0312 (GeneCopoeia)
hsa-miR-92a-1-5p HmiRQP0831 (GeneCopoeia)
hsa-miR-339-5p HmiRQP0427 (GeneCopoeia)
hsa-miR-10a-5p HmiRQP0032 (GeneCopoeia)