Skip to main content

Table 3 The Primer Sequences for RT-PCR

From: Oscillatory shear stress promotes angiogenic effects in arteriovenous malformations endothelial cells

Gene Primer sequence (5′–3′) No. of cycles Tm (℃)
AGP2 Forward TGGCTAGTGACCCCCTACAG 32 60
Reverse GCTGTGTTCTCTCCAGGCAT
AGP1 Forward CTCAGAGGGAATTGAGCACCC 32 57
Reverse ATTTGAAGCCCAGGGCAGAA
TGFβR1 Forward GCTTAGGGGTGTGGGTCTTC 32 58
Reverse AAGCCAAGTTTTCACCCCCA
GAPDH Forward GGAAGGTGAAGGTCGGAGTCA 32 59
Reverse GTCATTGATGGCAACAATATCCACT
  1. RT-PCR reverse transcriptase-polymerase chain reaction, AGP2 Angiopoietin2, AQP1 Aquaporin1, TGFβR1 tissue growth factor beta receptor1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, Tm temperature