Skip to main content

Table 1 Primer sequences

From: G protein coupled estrogen receptor attenuates mechanical stress-mediated apoptosis of chondrocyte in osteoarthritis via suppression of Piezo1

Target mRNA Sequence (5′–3′)
GPER Forward primer: 5′- TTAGGCCTGATACGTAGCTA -3′
Reverse primer: 5′- AGGCATTTCGCGATTAAGTT -3′
GAPDH Forward primer:5′- TGTGTCCGTCGTGGATCTGA -3′
Reverse primer: 5′- TTGCTGTTGAAGTCGCAGGA -3′