Skip to main content

Table 1 Primer sequences

From: G protein coupled estrogen receptor attenuates mechanical stress-mediated apoptosis of chondrocyte in osteoarthritis via suppression of Piezo1

Target mRNA

Sequence (5′–3′)

GPER

Forward primer: 5′- TTAGGCCTGATACGTAGCTA -3′

Reverse primer: 5′- AGGCATTTCGCGATTAAGTT -3′

GAPDH

Forward primer:5′- TGTGTCCGTCGTGGATCTGA -3′

Reverse primer: 5′- TTGCTGTTGAAGTCGCAGGA -3′

Back to article page

Molecular Medicine

ISSN: 1528-3658