Skip to main content

Table 2 The primer sequences

From: Hsp90 up-regulates PD-L1 to promote HPV-positive cervical cancer via HER2/PI3K/AKT pathway

Name Forward (5′–3′) Reverse (5′–3′)
HER2 AAAGGCCCAAGACTCTCTCC CTCTGGGTTCTCTGCCGTAG
PD-L1 ACCACCACCAATTCCAAGAG GATGGCTCCCAGAATTACCA
Hsp90 TGGACAGCAAACATGGAGAG AGACAGGAGCGCAGTTTCAT
GAPDH CCAGGTGGTCTCCTCTGA GCTGTAGCCAAATCGTTGT