Skip to main content

Table 1 Primers used for qPCR assay

From: lncRNA SNHG1 induced by SP1 regulates bone remodeling and angiogenesis via sponging miR-181c-5p and modulating SFRP1/Wnt signaling pathway

Gene Sequence (5′ → 3′)
SNHG1 Forward: TCCTTGTTCGGGGTTTGAGG
Reverse: ACAGCACCCTGACTACAAGC
miR-181c-5p Forward: GCCGAGAACATTCAACCTGTCG
Reverse: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACACTCAC
ALP Forward: AACCCAGACACAAGCATTCC
Reverse: CCAGCAAGAAGAAGCCTTTG
OCN Forward: AATCCAACGGTGTGAAGAGC
Reverse: CCTGCGTGGAGTATCCATCT
RUNX2 Forward: AGATGGGACTGTGGTTACCG
Reverse: GGACCGTCCACTGTCACTTT
NFATc1 Forward: GGTGCTGTCTGGCCATAACT
Reverse: GCGGAAAGGTGGTATCTCAA
RANKL Forward: CCTCACCATCAATGCTGCCA
Reverse: TGTAGGTACGCTTCCCGATG
CTSK Forward: CTTCCAATACGTGCAGCAGA
Reverse: TTGCATCGATGGACACAGAG
VEGF Forward: GAGAGAGGCCGAAGTCCTTT
Reverse: TTGGAACCGGCATCTTTATC
SP1 Forward: TGGGTACTTCAGGGATCCAG
Reverse: TGAGGCTCTTCCCTCACTGT
SFRP1 Forward: AAGCGAGTTTGCACTGAGGA
Reverse: TACTGGCTCTTCACCTTGCG
Wnt3a Forward: GGGCACTAACAAGTCGGGT
Reverse: GGGCATGATCTCCACGTAGT
β-catenin Forward: ACAGGGTGCTATTCCACGAC
Reverse: AGCAACTGCACAAACAATGG
U6 Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT
GAPDH Forward: AGCCCAAGATGCCCTTCAGT
Reverse: CCGTGTTCCTACCCCCAATG