Skip to main content

Table 1 Primers used in this study

From: Fibroblast growth factor 21 attenuates salt-sensitive hypertension-induced nephropathy through anti-inflammation and anti-oxidation mechanism

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
Mouse   
 FGF21 AGATCAGGGAGGATGGAACA TCAAAGTGAGGCGATCCATA
 IL-6 TCTATACCACTTACAAGTCGGA GAATTGCCATTGCACAACTCTTT
 TNF-α CCTGTAGCCCACGTCGTAG GGGAGTAGACAAGGTACAACCC
 GAPDH TTCCTACCCCCAATGTATACCG CATGAGGTCCACCACCCTGT
Human   
 IL-6 GCCAGAGCTGTGCAGATGAGT TGGCATTTGTCGTTGGGTCAG
 TNF-α TTCTGCCTGCTGCACTTTGGAG AGGGCTGATTAGAGAGAGGTCCCTG
 GAPDH AAAATCAAGTGGGGCGATGC GATGACCCTTTTGGCTCCCC