Skip to main content

Table 1 Primer sequences used for the qPCR analysis

From: Eriodictyol ameliorates cognitive dysfunction in APP/PS1 mice by inhibiting ferroptosis via vitamin D receptor-mediated Nrf2 activation

Gene Forward primer, 5ʹ-3ʹ Reverse primer, 5ʹ-3ʹ
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
TfRC GCCTTGCTCGGCAAGTAGAT TCCTCCGTTTCAGCCAGTTT
FTH AGAGCGGGCTGAATGCAATG ATATTCTGCCATGCCAGCTTCAG
Fpn CCAAGGCAAGAGATCAAACCCA CAGGATGATTCCGCAGAGGAT
VDR ATGAGGAGGTGCAGCGTAAG CATCGAGCAGGATGGCGATA
GPX4 CCTTCCCCTGCAACCAGTTT CCACGCAGCCGTTCTTATCA