Skip to main content

Table 1 Confirmed miRNA response elements in the 3’-untranslated region of TYMS mRNA

From: MALAT1-miRNAs network regulate thymidylate synthase and affect 5FU-based chemotherapy

miRNA Sequence (5’- > 3’) Targeted sites‡ References
miR-140-3p UACCACAGGGUAGAACCACGG 433–438 Wan et al. (2021)
miR-192-5p CUGACCUAUGAAUUGACAGCC 97–103 Song et al. (2010)
miR-197-3p UUCACCACCUUCUCCACCCAGC 321–327 Sun et al (2015); Wang et al (2019a)
miR-203a-3p GUGAAAUGUUUAGGACCACUAG 291–296, 327–332 Li et al. (2015a)
miR-215-5p AUGACCUAUGAAUUGACAGAC 97–103 Song et al. (2010)
miR-330-3p GCAAAGCACACGGCCUGCAGAGA 192–197, 506–511 Xu et al. (2017)
miR-375-3p UUUGUUCGUUCGGCUCGCGUGA 237–243 Xu et al. (2020b)
miR-433-3p AUCAUGAUGGGCUCCUCGGUGU 419–426 Gotanda et al. (2013)
miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG 56–61 Chen et al. (2017a)
  1. human miRNA (hsa-miR) sequences were taken from miRBase (www.mirbase.org); seed sequences complementary to the 3’UTR of TYMS mRNA are underlined
  2. 3’UTR TYMS mRNA sites targeted by miRNA seed sequences; the numbers refer to the position after the STOP codon according to the GenBank sequence accession number NM_001071.4; the sites confirmed by the luciferase reporter assay in the cited publication are underlined