MALAT1-miRNAs network regulate thymidylate synthase and affect 5FU-based chemotherapy

Table 1 Confirmed miRNA response elements in the 3’-untranslated region of TYMS mRNA

miRNA	Sequence (5’- > 3’)^†	Targeted sites‡	References
miR-140-3p	UACCACAGGGUAGAACCACGG	433–438	Wan et al. (2021)
miR-192-5p	CUGACCUAUGAAUUGACAGCC	97–103	Song et al. (2010)
miR-197-3p	UUCACCACCUUCUCCACCCAGC	321–327	Sun et al (2015); Wang et al (2019a)
miR-203a-3p	GUGAAAUGUUUAGGACCACUAG	291–296, 327–332	Li et al. (2015a)
miR-215-5p	AUGACCUAUGAAUUGACAGAC	97–103	Song et al. (2010)
miR-330-3p	GCAAAGCACACGGCCUGCAGAGA	192–197, 506–511	Xu et al. (2017)
miR-375-3p	UUUGUUCGUUCGGCUCGCGUGA	237–243	Xu et al. (2020b)
miR-433-3p	AUCAUGAUGGGCUCCUCGGUGU	419–426	Gotanda et al. (2013)
miR-1307-3p	ACUCGGCGUGGCGUCGGUCGUG	56–61	Chen et al. (2017a)

^†human miRNA (hsa-miR) sequences were taken from miRBase (www.mirbase.org); seed sequences complementary to the 3’UTR of TYMS mRNA are underlined
^‡3’UTR TYMS mRNA sites targeted by miRNA seed sequences; the numbers refer to the position after the STOP codon according to the GenBank sequence accession number NM_001071.4; the sites confirmed by the luciferase reporter assay in the cited publication are underlined

ISSN: 1528-3658