Skip to main content

Table 2 Primers Used for Real-Time RT-PCR

From: Transcription Factors in Muscle Atrophy Caused by Blocked Neuromuscular Transmission and Muscle Unloading In Rats

Gene Primer sequences Product (bp)
MAFbx Forward 5′ TCCTGGATTCCAGAAGATTCAAC 3′ Reverse 5′ TCAGGGATGTGAGCTGTGACTT 3′ 75
MuRF1 Forward 5′ ACAACCTCTGCCGGAAGTGT 3′ Reverse 5′ CCGCGGTTGGTCCAGTAG 3′ 67
18S Forward 5′ GTGCATGGCCGTTCTTAGTTG 3′ Reverse 5′ AGCATGCCGAGAGTCTCGTT 3′ 74