Skip to main content

Table 1 Sequence of the primers used in the quantitative Real Time PCR experiments.

From: Apert p.Ser252Trp Mutation in FGFR2 Alters Osteogenic Potential and Gene Expression of Cranial Periosteal Cells

Gene Forward sequence Reverse sequence
CENPN TCAGTGATGCTGCCCTGTTAGA AGTGATGCTGCCCTGTTAGACA
STMN1 GGCAGGACTTTCCTTATCCCA GGCAGGACTTTCCTTATCCCA
SPAG5 GAGTTCAAGGAGGTGCTGAAGA TGTCTGGAGGTCCTGCTATTTC
RMM2 CTTTGTCATCTTCCCCATCGAG TGCTGAATGTCCTTGGAGAGGT
HIP2 GAGTTCAAGGAGGTGCTGAAGA TGTCTGGAGGTCCTGCTATTTC
EEF1B2 TTCGGAGACCTGAAAAGCCCT CGGCTTCAAATACTGCCACATC
HPRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT
SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG