Skip to main content

Table 1 Oligonucleotides Used for Real Time RT-PCR

From: Differences in Extracellular Matrix Production and Basic Fibroblast Growth Factor Response in Skin Fibroblasts from Sporadic and Familial Alzheimer’s Disease

MRNA Sequence (5′-3′) Product (bp) GenBank Accession No.
betaglycan (sense) CCTGTCATTCCCAGCATACAAT 363 XM001924
betaglycan (reverse) ATCACCTGACTCCAGATCTTCATA   
Decorin (sense) GGCCACTATCATCCTCCTT 270 NM133503
Decorin (reverse) TTGTTGTTTTGCAGGTCTAGC   
syndecan (sense) TCTGACAACTTCTCCGGCTC 210 NM001006946
syndecan (reverse) CCACTTCTGGCAGGACTACA   
biglycan (sense) GCTCCGACCTGGGTCTGCTGAA 306 NM001711
biglycan (reverse) ACTCCCTTGGGCACCTTGC   
MMP-1 (sense) CTCATGCTTTTCAACCAGGC 370 X05231
MMP-1 (reverse) GTGCGCATGTAGAATCTGTC   
FGF2 (sense) AGTGTGTGCTAACCGTTACC 214 NM002006
FGF2 (reverse) AAGTATAGCTTTCTGCCCAGG   
β-actin (sense) ACCTTCTACAATGAGCTGCG 197 NM001101
b-actin (reverse) TCCATCACGATGCCAGTGGTA