Skip to main content

Table 1 The list of primers (forward and reverse) tested against the corresponding genes for expression in T cells.

From: Expression of a Broad Array of Negative Costimulatory Molecules and Blimp-1 in T Cells following Priming by HIV-1 Pulsed Dendritic Cells

Primer   
Blimp-1 Forward CAGCTCGCCCACCTGCAGAA
Reverse GCCGCAGCGCAGTTCCCTTT
BTLA Forward TGCCTGGTTTGTTTTCTTCCAGGC
Reverse TGGGTCATACCGCTGTTCTGCAA
CD160 Forward GCCTTGTGGCCCTTCAAGCTTTGT
Reverse TCCCCTGTGCCCTGTTGCAT
CTLA-4 Forward GGGCATAGGCAACGGAACCCA
Reverse GGGGGCATTTTCACATAGACCCCTG
Foxp3 Forward CAGCACATTCCCAGAGTTCCTC
Reverse GCGTGTGAACCAGTGGTAGATC
LAG-3 Forward CTAGCCCAGGTGCCCAACGC
Reverse GCCTGCGGAGGGTGAATCCC
PD-1 Forward CTCAGGGTGACAGAGAGAAG
Reverse GACACCAACCACCAGGGTTT
TIM-3 Forward AGGGGACATGGCCCAGCAGA
Reverse GCCAGCCCAGCACAGATCCC
TRAIL Forward CTTTACCAACGAGCTG
Reverse GTTATGTGAGCTGCTAC
β-Actin Forward AGAGGGAAATCGTGCGTGAC
Reverse CAATAGTGATGACCTGGCCGT
HVEM Forward CCGACGTCTTGAGGCTGGTGC
Reverse TGCCTGGAGGGCAGGGTTCA