Skip to main content

Table 1

From: Anx7 Is Required for Nutritional Control of Gene Expression in Mouse Pancreatic Islets of Langerhans

GK Rs1 Forward primer: CCTTTTCAGGCTTATACGCTCC
  Reverse primer: GGGTGAGCCCGCAGATG
IGF 1 Forward primer: CTACAAAAGCAGCCCGCTCT
  Reverse primer: CTTCTGAGTCTTGGGCATGTCA
NESTIN Forward primer: TTAAGGCCAGAACCCCCAC
  Reverse primer: CTCTGCATTTTTAGGATAGGGAGC
NEURO D1 Forward primer: CAATTTGGTCGCCGGCT
  Reverse primer: CCGGGTTCTGCTCAGGC
NGN 3 Forward primer: CCCAAGAGCGAGTTGGCA
  Reverse primer: TCCCGATCATTGGCCTTCT
PAX 4 Forward primer: GACACACCAGAAGAGGGTATCAGA
  Reverse primer: AAGTTCAAATCCCAGCAACCA
PTEN Forward primer: TGTGGTCTGCCAGCTAAAGGT
  Reverse primer: ACATGAACTTGTCCTCCCGC
GLUT 2 Forward primer: GCCAAGGACCCCGTCCT
  Reverse primer: AATTGCAGACCCAGTTGCTGA
IRS 2 Forward primer: GCATCGACTTCCTGTCCCA
  Reverse primer: CCTCAAGGTCAAAGGGCCTC
PDX 1 Forward primer: AAATCCACCAAAGCTCACGC
  Reverse primer: CTCGGGTTCCGCTGTGTAAG
Anx 7 Forward primer: TCCCCACTGCGGGTCA
  Reverse primer: CCTCCTCCCATTGGTGGAA
HPRT Forward primer GTTGGATACAGGCCAGACTTTGTTG
HPRT Reverse primer GATTCAACTTGCGCTCATCTTAGGC