Skip to main content

Table 1 Primers and probes used for real-time PCR

From: Semicarbazide-Sensitive Amine Oxidase (SSAO) Gene Expression in Alloxan-induced Diabetes in Mice

Gene Primer/probe   Product
SSAO Forward 5′TGCACATCCCTCATGCAGAA 3′  
  Reverse 5′ GGAGGAAGAAGCCCACTGAGT 3′ 69 bases
  Probe 5′FAM-ATCCCCAACACGGTGAC TGCGG-TAMRA 3′