Skip to main content

Table 1 Oligonucleotides and PCR product size for seven target genes

From: The Molecular Basis of Increased Glomerulosclerosis after Blockade of the Renin Angiotensin System in Growth Hormone Transgenic Mice

Species 5′ Primers 3′ Primers Size
α1IV Collagen TAGGTGTCAGCAATTAGGCAGG CGGACCACTATGCTTGAAGTGA 484
α2IV Collagen ACTCATTCCAACCGTCTGTCAGC GCAAATCATTGACAGTGGCGTCTA 562
α1I Collagen TGGTCCCTCTGGAAATGCTGGACC CAGGAGAACCAGGAGAACCAGG 297
α SMC Actin CCTGACGGACTACCTCATG CAAATCAAAGCTTTGGGCAG 434
β Actin TCTAGGCACCAAGGTGTG TCATGAGGTAGTCCGTCAGG 460
72 kD Gelatin CTTTGCAGGAGACAAGTTCTGG TTAAGGTGGTGCAGGTATCTGG 701
bovine GH GAGGAAACTGAGGAGTTCAGC TCCACTGCCATCCAACAACC 395