Skip to main content

Table 1 RT-qPCR primer sequences

From: OSMR gene effect on the pathogenesis of chronic autoimmune Urticaria via the JAK/STAT3 pathway

Genes Sequences
OSMR F: 5’-AGAAACTGGCACACCATCCT-3′
R: 5’-ACTGCCCTAATGACCAGTGC-3′
STAT3 F: 5’-GCCACGTTGGTGTTTCATAATC-3′
R: 5’-TTCGAAGGTTGTGCTGATAGAG-3′
JAK2 F: 5’-TGCTGTCCAGACAAGAATGC-3′
R: 5’-TCCTTCTCTGCCAACGTCTT-3′
ISG15 F: 5’-CACAGTCCTGCTGGTGG-3′
R: 5’-GGCGATACTGCGACCCT − 3′
CRK F: 5’-GGCAGGGTAGTGGAGTGAT-3′
R: 5’-AGGCTGTCTTGTCGTAGGC-3′
IRF9 F: 5’-TGCTTCCTCCAGAGCCAGAC-3′
R: 5’-CACAAGGCGGCAATCCAG-3’
GAPDH F: CCACCCATGGCAAATTCCATGGCA
R: TCTAGACGGCAGGTCAGGTCCAC
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, OSMR oncostatin M receptor, STAT3 signal transducer and activator of transcription 3, JAK2 janus kinase 2, ISG15 interferon-stimulated gene 15, CRK CT10-regulated kinase, IRF9 interferon regulatory factor 9, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse