Skip to main content

Table 1 Primer sequences of the germ layer differentiation markers for qPCR assay

From: Murine exposure to gold nanoparticles during early pregnancy promotes abortion by inhibiting ectodermal differentiation

Primer sequence (5’—3’) Primer name Purification method Attribution of differentiation marker
CATGGCCTTCCGTGTTCCTA mGAPDH_F PAG Internal reference
CCTGCTTCACCACCTTCTTGAT mGAPDH_R PAG Internal reference
ACCTGAGCTATAAGCAGGTTAAGAC mNanog_F PAG Sternness
GTGCTGAGCCCTTCTGAATCAGAC mNanog_R PAG Sternness
TTACTTCCCGCCAGCTCTTC rnSoxl_F PAG Neuroectederm
TGATGCATTTTGGGGGTATCTCTC mSoxl_R PAG Neuroectoderm
GGCAACTATGTAGGGGACTCAG mTubb3_F PAG Neuroectederm
CCTGGGCACATACTTGTGAG mTubb3_R PAG Neuroectederm
CTCCAACCTATGCGGACAAT mT_F PAG Mesendoderm
AGACTGGGATACTGGCTAGAG mT_R PAG Mesendodetm
CCCATCCTGGACCGTTTCC mLhxl_F PAG Mesoderm
CGCTTGGAGAGATGCCCTG mLtaxl_R PAG Mesoderm
CACATGAAGGAGTACCCGGACTA mSox3_F PAG Ncurocctodcrm
TGAGCAGCGTCTTGGTCTTG mSox3_R PAG Neuroectederm
CGAGCCAAAGCGGAGTCTC mSoxl7_F PAG Fmlodenri
TGCCAAGGTCAACGCCTTC mSoxl7_R PAG Fndodcrm