Skip to main content

Table 2 Human primers

From: Loss of intestinal sympathetic innervation elicits an innate immune driven colitis

Gene Forward sequence Reverse sequence
IL-1β GAAGCTGATGGCCCTAAACA AAGCCCTTGCTGTAGTGGTG
IL-6 AGTGAGGAACAAGCCAGAGC GTCAGGGGTGGTTATTGCAT
IL-10 GCCACCCTGATGTCTCAGTT GTGGAGCAGGTGAAGAATGC
IL-12 ATGCCTTCACCACTCCCAAA TAGAGTTTGTCTGGCCTTCTGG
TNF-α CCTGCTGCACTTTGGAGTGA GAGGGTTTGCTACAACATGGG
β-actin AGAGCTACGAGCTGCCTGAC AGCACTGTGTTGGCGTACAG
β2 microglobulin CTCGCGCTACTCTCTCTCTTTCT TGCTCCACTTTTTCAATTCTCT