Skip to main content

Table 1 Primer Sequences

From: Curcumin induced oxidative stress attenuation by N-acetylcysteine co-treatment: a fibroblast and epithelial cell in-vitro study in idiopathic pulmonary fibrosis

Gene Forward Sequence Reverse Seqeunce
18S GATGGGCGGGGAAAATAG GCGTGGATTCTGCATAATGGT
HIF1A CCAACCTCAGTGTGGGTATAAG CTGTGGTGACTTGTCCTTTAGT
SOD2 CCCAGAACAGGACAGAGAATG AGGTGTAAGCCCACGTTTATC
CAT GGTAACCCAGTAGGAGACAAAC CGAGATCCCAGTTACCATCTTC
NRF2 TGCTCAATGTCCTGTTGC GAGAGCCCAGTCTTCATTG
PCNA TCCCACGTCTCTTTGGTGC TCTTCGGCCCTTAGTGTAA
ACTA2 AGTTACGAGTTGCCTGAT GAGGTCCTTCCTGATGTCAA
p53 AAGATGCAGGAACCGTCAGG CCTGCGTCTGGAACTGGAAT
p21 GAGACTAAGGCAGAAGATGTAGAG GCAGACCAGCATGACAGAT
CCND1 GTGCTGCGAAGTGGAAACC ATCCAGGTGGCGACGATCT
COL1A1 GTCGAGGGCCAAGACGAAG CAGATCACGTCATCGCACAAC