Skip to main content

Table 1 Primers used for qRT-PCR

From: Gut microbiota promote the inflammatory response in the pathogenesis of systemic lupus erythematosus

Gene Primer
IRF7 Forward: GCGTACCCTGGAAGCATTTC
Reverse: GCACAGCGGAAGTTGGTCT
CSK Forward: TCATGTGGGGTCTAGCAGGTA
Reverse: AGGGCTTGGCTATCTGACTG
GAPDH Forward: AACTTTGGCATTGTGGAAGG
Reverse: GGATGCAGGGATGATGTTCT