Skip to main content

Table 1 Primer sequences

From: TFPI2 suppresses breast cancer progression through inhibiting TWIST-integrin α5 pathway

IDSequence(5′- 3′)
GAPDH FACCACAGTCCATGCCATCAC
GAPDH RTCCACCACCCTGTTGCTGTA
TFPI2 FGGGTTTATGGTGTAGGGGG
TFPI2 RCAACCACCCCTCAAACTCC