Skip to main content

Table 1 Primers for the study

From: MicroRNA-214 modulates the senescence of vascular smooth muscle cells in carotid artery stenosis

Genea Accession number Primer sequence (5′ to 3′)
Forward/reverse
Amplicon (bp)
NOS3 NM_021838.2 F: CTGCGGTGATGTCACTATGG
R: AAATGTCCTCGTGGTAGCGT
140
CXCR4 NM_022205.3 F: ATCATCTCCAAGCTGTCACACTCC
R: GTGATGGAGATCCACTTGTGCAC
197
CXCL12 NM_022177.3 F: GCTCTGCATCAGTGACGGTAAG
R: TGGCGACATGGCTCTCAAA
77
TERF1 NM_001012464.1 F: TACCAAACTCAAGCCCCATC
R: GCAGCAAACTCACATCGAAA
170
TERF2 NM_001108448.1 F: AGAAGAAAGCGAGTGGGTGA
R: TTGTGAGTCCTGTGGCTCTG
178
TERT NM_053423.1 F: AGTGGTGAACTTCCCTGTGG
R: CAACCGCAAGACTGACAAGA
232
VEGFA NM_031836.3 F: TCGAGGAAAGGGAAAGGGTCAA
R: TTTGCAGGAACATTTACACGTCTGC
139
  1. aRattus norvegicus database; bp base pair Nos3, nitric oxide synthase 3, Cxcr4 C-X-C chemokine receptor type 4, Cxcl12 stromal cell-derived factor 1, Terf telomeric repeat-binding factor, Tert telomerase reverse transcriptase, VEGFA vascular endothelial growth factor A