Skip to main content

Table 1 Primer base sequence

From: Pirfenidone alleviates pulmonary fibrosis in vitro and in vivo through regulating Wnt/GSK-3β/β-catenin and TGF-β1/Smad2/3 signaling pathways

GeneForward (5′-3′)Reverse (5′-3′)
Col-ICAATGGCACGGCTGTGTGCGCACTCGCCCTCCCGTCTTTGG
Col-IIITGGTCCCCAAGGTGTCAAAGGGGGGTCCTGGGTTACCATTA
α-SMAGGCAACCTCAAGAAGTCCCGTGCAGCCATCCACAAGC
fibronectinTGGAACTTCTACCAGTGCGACTGTCTTCCCATCATCGTAACAC
VimentinGACGCCATCAACACCGAGTTCTTTGTCGTTGGTTAGCTGGT
E-cadherinCGAGAGCTACACGTTCACGGGGGTGTCGAGGGAAAAATAGG
N-cadherinCTCCTATGAGTGGAACAGGAACGTTGGATCAATGTCATAATCAAGTGCTGTA
GAPDHCACTGGGCTACACTGAGCACAGTGGTCGTTGAGGGCAAT