Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Involvement of Hdac3-mediated inhibition of microRNA cluster 17-92 in bronchopulmonary dysplasia development

Target Primer sequence (5′-3′)
miR-17-92 F: TGAGGGCACTTGTAGCATTATG
R: CCTTAGAACAAAAAGCACGCAG
miR-17-5p F: GCGAATTCCAAATTTAGCAGGAATAAAG
R: CGCTCGAGGACTGGACGCAGCCAGTG
Pgf F: TTCCCCTTGGTTTTCCTCCTT
R: AGATCTTGAAGATTCCCCCCA
GAPDH F: AAATGGTGAAGGTCGGTGTGAACG
R: ATCTCCACTTTGCCACTGC
U6 F: GAACCTCACCTTGGGACTGA
R: TGCTACAAGTGCCCTCACTG
  1. F forward, R reverse