Skip to main content

Table 1 Primers sequences used in this study

From: Knockdown of circROBO2 attenuates acute myocardial infarction through regulating the miR-1184/TRADD axis

Name Sequence (5′–3′)
circROBO2 Forward: TCTGGTATTGCCTGGAACGCCAA
Reverse: CAGTGGTAATCAAGTGGAGAATC
ROBO2 Forward: ACCTTTGGGTGGGGAAGTGA
reverse: GCAACACCTCGGTATACCGA
TRADD Forward: GAGCCACTTAGAATCGAGGA
Reverse: CTGAGGCTATAGATTCGTGCC
miR-1184 Forward: GAGCTAGCGAATGGCACCCT
Reverse: GCAGGAACGAAGTCGACTTA
si-TRADD Sense: ATCTTGAGCCATTCACCGGAA
si-circROBO2 Sense: AGGCTGAGCTAATACAGTA
U6 Forward: AGAGAAGATTAGCATGGCCCCTG
Reverse: AGTGCAGGGTCCGAGGTATT
GAPDH Forward: CCAAGGTCATCCATGACAAC
Reverse: GCTTCACCACCTTCTTGATG