Skip to main content

Table 1 A list of primers used in real-time PCR analysis

From: LRRC4 functions as a neuron-protective role in experimental autoimmune encephalomyelitis

Gene Forward Reverse
GAPDH AGTGGCAAAGTGGAGATTGTTG TGTTAGTGGGGTCTCGCTCC
LRRC4 TGCTGCCATGTTGATTGTC GTGCTGGTTTGTAGGTGTTGT
Rab7b TGGCAAAGATTATCCCTA ATTCTTCGCACTAACTTCA
IL-6 TTGCCTTCTTGGGACTGATG CACGATTTCCCAGAGAACATG
IL-10 ACATACTGCTAACCGACTCC AGGGTCTTCAGCTTCTCAC
TNF-α GGCGGTGCCTATGTCTCAG GGCTACAGGCTTGTCACTCG
IL-17A CTCAGACTACCTCAACCGTTC TGTGGTGGTCCAGCTTTCC
TGF-β AGCAACAATTCCTGGCGATAC CTAAGGCGAAAGCCCTCAAT
IFN-γ CAAGTGGCATAGATGTGGAAG TGCTGATGGCCTGATTGTC