Skip to main content

Table 1 Primers sequence for PCR

From: Lansoprazole-induced osteoporosis via the IP3R- and SOCE-mediated calcium signaling pathways

Genes Forward (5′–3′) Reverse (3′–5′)
OCN AGACTCCGGCGCTACCTTGG CGGTCTTCAAGCCATACTGGTCTG
ALP TCATTCCCACGTTTTCACATTC GTTGTTGTGAGCGTAATCTACC
COLΙα GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG
Runx2 ATGCTTCATTCGCCTCACAAA GCACTCACTGACTCGGTTGG
Caspase-12 TGGCCCATGAATCACATCTAAT TGGACAAAGCTTCAGTGTATCT
ATF4 TGGCTGGCT GTGGATGG TCCCGGAGAAGGCATCCT
GAPDH GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTTCTTACTCC
ATP2B1 AGATGGAGCTATTGAGAATCGCA CCCTGTAACACGGATTTTTCCTT