Skip to main content

Table 1 Primers used for qRT-PCR analysis

From: Antibody-drug conjugates targeting CD248 inhibits liver fibrosis through specific killing on myofibroblasts

Target Forward primer Reverse primer
Cd248 CTCAACCAACTATCCCCAAGTC GCCTGGGTTCTGATACCTGG
Acta2 CCGCCATGTATGTGGCTATT CAGTTGTACGTCCAGAGGCATA
Col1a1 AGACATGTTCAGCTTTGTGGAC GCAGCTGACTTCAGGGATG
Tgfbr1 CACAGAGTGGGAACAAAAAGGT CCAATGGAACATCGTCGAGCA
Pdgfrα ATGAGAGTGAGATCGAAGGCA CGGCAAGGTATGATGGCAGAG