Skip to main content
Download PDF
  • Original Articles
  • Published:

Molecular Characterization of a Dual Endothelin-1/Angiotensin II Receptor

Molecular Medicine volume 4, pages 96–108 (1998)Cite this article

Abstract

Background

The molecular recognition theory (MRT) provides a conceptual framework that could explain the evolution of intermolecular and intramolecular interaction of peptides and proteins. As such, it predicts that binding sites of peptide hormones, and its receptor binding sites were originally encoded by and evolved from complementary strands of genomic DNA.

Materials and Methods

On the basis of principles underlying the MRT, we screened a rat brain complementary DNA library using an AngII followed by an endothelin-1 (ET-1) antisense oligonucleotide probe, expecting to isolate potential cognate receptors.

Results

An identical cDNA clone was isolated independently from both the AngII and ET-1 oligonucleotide screenings. Structural analysis revealed a receptor polypeptide containing a single predicted transmembrane region with distinct ET-1 and AngII putative binding domains. Functional analysis demonstrated ET-1-and AngII-specific binding as well as ET-1- and AngII-induced coupling to a Ca2+ mobilizing transduction system. Amino acid substitutions within the predicted ET-1 binding domain obliterate ET-1 binding while preserving AngII binding, thus defining the structural determinants of ET-1 binding within the dual ET-1/AngII receptor, as well as corroborating the dual nature of the receptor.

Conclusions

Elucidation of the dual ET-1/AngII receptor provides further molecular genetic evidence in support of the molecular recognition theory and identifies for the first time a molecular link between the ET-1 and AngII hormonal systems that could underlie observed similar physiological responses elicited by ET-1 and AngII in different organ systems. The prominent expression of the ET-1 /AngII receptor mRNA in brain and heart tissues suggests an important role in cardiovascular function in normal and pathophysiological states.

Introduction

The hydropathic character of an amino acid appears to be determined by the second base of a particular codon (1). A second base, U, generally specifies hydrophobic amino acids, while a second base. A, specifies hydrophilic amino acids (1). Since A and U are complementary, amino acid sequences derived from complementary DNA strands will generate peptides of inverted patterns of hydropathy. This fundamental observation provides the basis for the molecular recognition theory, which hypothesizes that complementary nucleotide sequences specify peptides that could interact through complementary structures as a result of their exactly inverted pattern of amino acid hydropathy (1). This theory further suggests that binding sites of interacting proteins, such as peptide hormone and receptors (2), and peptide substrate and enzyme (3), evolved from complementary strands of genomic DNA. This molecular paradigm further implies that the antisense peptide encoded by the antisense strand of peptide hormone mRNAs (spanning the hormone) represent the putative evolutionary precursor binding domain of corresponding peptide hormones. As a corollary, it can be envisioned that mutations in these precursor binding domains favoring an increased ligand-receptor affinity have occurred over time, leading to today’s respective binding domains.

Numerous biochemical studies have reported experimental evidence in support of this theory (4,5). However, the molecular recognition theory still remains controversial because of some negative biochemical and theoretical analysis (6–10). Our recent report identifying the AngII/AVP receptor represents the first molecular genetic evidence in support of this theory (11). Our current studies were designed to further test this theory by screening a rat brain complementary DNA library using an AngII followed by an endothelin-1 (ET-1) antisense oligonucleotide probe to potentially isolate additional AngII and ET-1 receptor isoforms. As with the AngII/AVP receptor (11), an identical cDNA clone was isolated independently from both the AngII and ET-1 oligonucleotide screenings. Functional and mutational studies of the predicted polypeptide elucidates a novel dual ET-1/AngII receptor, providing further molecular genetic evidence in support of the molecular recognition theory, as well as demonstrating for the first time a molecular link between the ET-1 and AngII hormonal systems. The identification of the structural determinants of hormone binding within the dual ET-1/AngII receptor provides new insight into the evolutionary origin of hormone-binding domains present in different iso-receptors.

Materials and Methods

cDNA Screening and Nucleotide Sequencing

An adult rat brain Agtl 1 cDNA library (Clontech) was screened twice independently with the ET-1 [5′ - CC AGATGATGTCCAGGTGGCAGAAGTAGA CACACTCTTTATCCATCAGGGAAGAGCAGGAG CA-3′] (12) and AngII [5′-AAAGGGGTGGATGT ATACGCGGTC-3′] (13) antisense oligonucleotide probes. Hybridizations were done as described (11). After the first round of hybridization, a significant number of potential positive signals were detected. Of these, we proceeded to isolate five cDNA clones hybridizing to the AngII probe and three cDNA clones hybridizing to the ET-1 probe. These clones showed the greatest signal to background ratio and they represented less than 5% of the potential positive signals. Among these clones we detected the 3.3-kb cDNA isolated in both AngII and ET-1 screenings. The 3.3-kb cDNAs were subcloned into Ml3 vectors and subsequently sequenced on both strands as described elsewhere (11). DNA sequence analysis was done using the GENEPRO computer DNA analysis program (Riverside Scientific Enterprises).

Expression Studies in Cos1pMAM-ET-1/AngII Transfectants

The 756-bp SspI-EcoRI fragment spanning nucleotides 2518–3274 of the full-length ET-1/AngII receptor cDNA was subcloned directionally (5′ – 3′) into the Nhel site of the pMAMneo expression vector (Clontech). The pMAM-ET-1/AngII expression vector was then transfected into Cosl cells and stable transfectants were selected and maintained in G418 for subsequent studies. Expression of mutant receptors was done similarly using the pMAM-ET-1/AngII R64G and pMAM-ET-1/AngII W65G expression vectors. 45Ca2+ efflux assays were done essentially as previously described (14). Cell cultures (P 35 dishes) were equilibrated with 45Ca2+ under standard growth conditions (DMEM + 10% FCS + 250 µg/ml G418 + 5 µCi/ml of 45CaCl2) for 18 to 20 hr. Assays were initiated by removal of the 45Ca2+ media and followed by rapid sequential washing and aspirations with three 1-ml aliquots of physiological buffer (PB composition in mmol/L: NaCl 140; KCl 5.4; CaCl2 1.8; MgCl2 1.6; D-glucose 5.5; Hepes 5, pH 7.4). One milliliter of assay solution containing appropriate ligands dissolved in PB were promptly added and efflux was allowed to proceed for the specific time intervals. Efflux was terminated by rapid washing and aspiration with three 1-ml aliquots of MgCl2-free PB containing 5 mmol/L LaCl3. Residual 45Ca2+ content was expressed relative to total isotope present in cultures that received the wash protocol without any intervening efflux interval (time 0 = 12,050 ± 941 cpm). All assays were done at 37°C. 125I-ET-1 binding experiments were performed on intact cells in Dulbecco’s modified Eagle medium (DMEM) supplemented with 20 mmol/L Hepes, pH 7.3 and 0.1 % bovine serum albumin (BSA). Incubations were performed at 37°C for 60 min. 125I-AngII binding experiments were performed as described elsewhere (11). Specific binding was determined as the difference between the total radioactivity bound to cells and the radioactivity bound to blanks containing 1 µmol/L ET-1 or 1 µmol/L AngII. Affinity constants were determined by Scatchard analysis (RADLIG, Version 4 Program, McPherson).

Immunocytochemistry

A polyclonal rabbit antipeptide antibody (custom-made by Multiple Peptide Systems, San Diego, CA) was raised against the synthetic peptide P51LLTSLGSKE60 spanning a portion of the predicted extracellular domain of the ET-1/AngII receptor. Control CoslpMAMneo and test Cos1pMAM-ET-1/AngII cells were reacted with this antibody (1:500) and immunostained as described previously (11).

Site-Directed Mutagenesis

Mutants were constructed by oligonucleotide-directed mutagenesis using the Transformer Site-Directed Mutagenesis Kit (Clontech) and the pMAM-ET-l/AngII756 as template. Mutagenic oligonucleotides were as follows: 5′-CCA-GTT-CCA-GCC-AGA-CTT-CAT-CTC-3′ (antisense strand) replacing the codon CGC (R64) by GGC (G64) and 5′-CCA-GTT-CCC-GCG-AGA-CTT-CAT-CTC-3′ (antisense strand) replacing the codon TGG (W65) by GGG (G65). Both mutants were verified by nucleotide sequencing of the entire amino acid coding region of the ET-1/AngII receptor to ensure the absence of unwanted mutations. Mutant recombinants were called pMAM-ET-1 /AngII R64G and pMAM-ET-1/AngII W65G.

Results

Isolation of the Identical cDNA Clone from Independent AngII and ET-1 Screenings

The isolation of the ET-1/AngII receptor cDNA was accomplished by using the same strategy employed for the identification of the dual AngII/ AVP receptor (11). In this particular case, we screened 0.5 × 106 recombinants from an adult rat brain cDNA library using a 24-base AngII antisense oligonucleotide probe followed by a 6 3-base ET-1 antisense oligonucleotide probe (see Materials and Methods). Unexpectedly, an identical cDNA clone, approximately 3.3 kb in length, was isolated independently from the AngII and ET-1 oligonucleotide screening. With the precedence of a dual AngII/AVP receptor (11), the logical prediction was that this 3.3-kb brain cDNA might encode a dual ET-1 /AngII receptor.

Structural Analysis of the ET-1/AngII Receptor cDNA

Nucleotide sequence analysis of the 3.3-kb ET-1/AngII receptor cDNA revealed a single open reading frame (ORF) encoding a protein of 127 amino acids with a predicted molecular mass of 13,698 daltons (Fig. 1A). A single region with significant homology was found for each antisense peptide sequence in the 127 amino acid (aa) ORF. Comparison of the ET-1 and AngII cRNA (complementary RNA) sequences with the nucleotide and amino acid sequences of the ET-1/AngII receptor identified E60MKSRWNW67 as a potential ET-1 binding domain (Fig. 1C), and G41AASMQV47 as a potential AngII binding domain (Fig. 1C) within the ET-1/AngII receptor. This analysis also delineates the antisense peptide from frame 2 as the putative evolutionary ET-1 precursor binding domain (Fig. 1C), whereas the antisense peptide from frame 3 is the putative evolutionary AngII precursor binding domain (Fig. 1C). Consistently, the single region with the highest nucleotide sequence homology to the AngII oligonucleotide probe (63% identity spanning nucleotides [nt] 2802–2820) and the single region with the highest nucleotide sequence homology to the ET-1 oligonucleotide probe (65% identity spanning nt 2859–2881) are distinct and correspond to the AngII and ET-1 antisense peptide homology regions (Fig. 1). According to the molecular recognition theory, these antisense homology regions should identify putative AngII and ET-1 binding domains, respectively.

Fig. 1
figure 1

Sequences and structural features of the ET-1/AngII receptor. (A) The deduced amino acid sequence is presented underneath the nucleotide sequence with the single hydrophobic (H-l) putative transmembrane domain underlined. The serine and threonine residues with consensus sequences for cAMP-dependent protein kinase (18,19) located within the intracellular domain are highlighted. The regions depicting 12/19 homology with the AngII cRNA-based oligonucleotide probe [1] and 15/23 homology with the ET-1 cRNA-based oligonucleotide probe [2] are marked; identical nucleotides are dotted. Putative AngII and ET-1 binding domains, and internalization recognition sequences (IRS) are bracketed. Amino acids identical to antisense peptide and conservative amino acid substitutions are highlighted (boldface) within corresponding putative binding domains. *, denotes stop codon. (B) Schematic structure of the ET-1/AngII receptor depicting the extracellular, transmembrane, and cytoplasmic domains. The following functional domains are highlighted: putative AngII binding domain, AngII, amino acids 41–48 (red); putative ET-1 binding site, ET-1, amino acids 60–67 (yellow); potential cAMP-dependent protein kinase phosphorylation sites (S91, T108) (green), a potential IRS, [Y111RRP114] (orange), showing homology to the human lysosomal acid phosphatase IRS (21); and amino acids R64 and W65 involved in the site directed mutagenesis. (C) Comparison of the ET-1 and AngII cRNA sequences with the nucleotide and amino acid sequence of the ET-1/AngII receptor identifies aa60–67 and aa41–47 as potential ET-1 and AngII binding domains, respectively. The stippled areas indicate regions of homology. Nucleotides encompassing the ET-1 /AngII receptor ET-1 and AngII binding domains that are present in identical codon position within the corresponding antisense peptide (AP) frames are indicated by asterisks.

Full size image

Hydropathy analysis using the Kyte-Doolittle scale (15) and GES hydropathy plot (16) predicts a single transmembrane domain (H-l; Fig. 1A). H-l (n = 20 amino acids) is predicted to cross the plasma membrane considering that a transmembrane region of 12–14 amino acids have been experimentally proven to be sufficient to cross the plasma membrane (17). The existence of a single transmembrane-spanning region in conjunction with the identification of the putative AngII and ET-1 binding domains within the amino terminal end predict the localization of the ET-1/AngII receptor amino terminal end to the extracellular side (Fig. 1B). Two potential phosphorylation sites for cAMP-dependent protein kinase, S91 and T108 (18,19), can be noted in the predicted cytoplasmic carboxyl-end (Fig. 1). A potential internalization recognition sequence (IRS) is also found in the cytoplasmic carboxyl-end: Y111RRP114 (Fig. 1), resembling the IRS present in human lysosomal acid phosphatase (20,21). The structural features of the ET-1/AngII polypeptide are consistent with a single-transmembrane dual hormone receptor containing distinct ET-1 and AngII binding domains.

Functional Analysis of the ET-1/AngII Receptor

Although no other significant ORFs were detected in the cDNA, because of the unusual structure of the ET-1/AngII receptor and the localization of the ET-1/AngII receptor ORF to the 3′ end (Fig. 1A), we tested the possibility that this mRNA could be polycistronic in nature, thus encoding additional polypeptides within the long 5′ UT (approximately 2.7 kb) necessary for receptor function. For this purpose, two different expression vectors were constructed. The 3274-bp ET-1/AngII receptor cDNA was subcloned directionally (5′ to 3′) into the NheI site of the pMAMneo expression vector (Clontech) to generate pMAM-ET-l/AngII3274. Similarly, a 756-bp SspI-EcoRI fragment spanning nucleotides 2518–3274 of the full-length cDNA (including the 127 aa ORF, Fig. 1A) was subcloned into the pMAMneo expression vector to generate pMAM-ET-l/AngII756. Both expression vectors were stably transfected into Cos 1 cells and assayed for 125I-AngII and 125I-ET-1 binding. These binding experiments showed equivalent expression of ET-1/AngII receptors in CoslpMAM-ET-1/AngII3274 and Cos1pMAM-ET-1/AngII756 transfectants (data not shown). These results demonstrate that the predicted 127 aa open reading frame is necessary and sufficient for receptor function and that the 127 aa polypeptide can interact specifically with ET-1 and AngII as predicted by the structural analysis (Fig. 1). Control nontransfected and mock-transfected cell did not reveal any binding or activation of second messenger systems upon addition of ET-1 and AngII. All subsequent experiments presented below were conducted with CoslpMAM-ET-1/AngII756 transfectants (abbreviated as Cos1pMAM-ET-1/AngII).

Because ET-1 receptors are functionally coupled to a Ca2+ mobilizing transduction system involving phospholipase C (22), the Cos1pMAM-ET-1/AngII transfectants were tested for their ability to support peptide hormone-induced Ca2+ mobilization. Analysis of a panel of peptide hormones revealed that Cos1pMAM-ET-1/AngII transfectants responded to ET-1 and AngII (Fig. 2A, B). Measured as the % 45Ca2+ efflux activity indicated by % 45Ca2+ retained (14), 100 nmol/L ET-1 and 100 nmol/L AngII elicited equivalent amounts of Ca2+ mobilization (Fig. 2B). No responses were elicited by either arginine-vasopressin (AVP) or bradykinin. In comparison to ET-1, ET-2 induced 60% 45Ca2+ efflux activity, whereas ET-3 induced none at all. Similarly, compared with AngII, AngIIl induced 25% 45Ca2+ efflux activity, whereas Angl induced none at all (Fig. 2B). The effects of antagonists on the ET-1/AngII receptor were also analyzed. An AngII-specific antagonist (Sar1, Ala8-AngII) efficiently blocked both AngIIand ET-1-induced 45Ca2+ efflux (Fig. 2B). This is consistent with the notion that AngII- and ET-1-induced responses were mediated by the same receptor.

Fig. 2
figure 2

Functional characterization of the ET-1/AngII receptor expressed in Cos1pMAM-ET-1/AngII cells. (A) ET-1 (0.1 µmol/L) and AngII (0.1 µmol/L) induced 45Ca2+ mobilization in intact CoslpMAM-ET-1/AngII cells. 45Ca2+ efflux was measured as the % 45Ca2+ retained at 10, 20, and 30 sec. (B) Stimulation of 45Ca2+ mobilization (measured as % 45Ca2+ efflux activity at 30 sec) in response to various peptide ligands (0.1 µmol/L): AngII, AngIII, AngI, ET-1, ET-2, ET-3, AVP, and Bradykinin (Bradyk). Inhibition of 45Ca2+ efflux activity by Sar1, Ala8-AngII was tested with the concurrent incubation of AngII (1 nmol/L) or ET-1 (1 nmol/L) and Sar1, Ala8-AngII at 100 nmol/L. (C) Concentration dependence of the ET-1-induced 45Ca2+ mobilization (measured as % 45Ca2+-efflux activity at 30 sec). (D) Concentration dependence of the AngII-induced 45Ca2+ mobilization (measured as % 45Ca2+ efflux activity at 30 sec). (E) Competition for I25I-ET-1 specific binding by ET-1 (■), ET-2 (○), ET-3 (△), and AngII (♦). (F) Competition for 125I-AngII-specific binding by AngII (■), Losartan (○), PD123319 (▲), and ET-1 (□). Each curve is representative of at least three independent experiments performed in quadruplicate. Bars represent the ranges of intraexperimental variation.

Full size image

The specificities of the ET-1 and AngII responses of the dual ET-1/AngII receptor were then assessed in concentration dependence assays measuring ET-1- and AngII-induced 45Ca2+ efflux. The response to both ET-1 and AngII were similar with equivalent effector concentration for half-maximal response (EC50) values of 7 ± 1.4 pmol/L (Fig. 2C) and 6 ± 0.9 pmol/L (Fig. 2D), respectively. Pharmacologic specificity was further ascertained by ligand dissociation studies. As shown in Fig. 2E and F, high (KH) and low (KL) affinity sites were detected for both ET-1 and AngII with KH of 0.05 ± 0.01 nmol/L for ET-1 (Bmax = 6.0 ± 1.2 fmol 10−6 cells) and 0.27 ± 0.046 nmol/L for AngII (Bmax = 5.4 ± 0.8 fmol 10−6 cells). The KL for ET-1 was 50 ± 13.5 nmol/L (Bmax = 72 ± 11.0 fmol 10−6 cells); KL for AngII was 16 ± 2.4 nmol/L (Bmax = 78 ± 9.4 fmol 10−6 cells). Interestingly, 125I-ET-1 was not displaced by AngII, nor was 125I-AngII displaced by ET-1 (Fig. 2E, F). Displacement of ET-1 by ET-2 was also detected with high- and low-affinity sites with a KiH of 1 ± 0.13 nmol/L and KiL of 300 ± 33 nmol/L (Fig. 2E). In contrast, ET-3 displayed a single low-affinity site with a KiL of 20 ± 1.6 nmol/L (Fig. 2E). Displacement of AngII by the AT1 receptor-specific antagonist, Losartan, was detected with a KiH of 0.7 ± 0.14 nmol/L and KiL of 160 ± 19 nmol/L (Fig. 2F). The AT2-specific antagonist, PD123319, did not displace AngII binding up to concentrations of 10−5 mol/L (Fig. 2F). These results define the ET-1/AngII receptor as a novel AT1 receptor isoform coupled to Ca2+-mobilizing pathways.

Immunocytochemical Localization of the ET-1/AngII Receptor

In order to ascertain the cytolocalization and predicted topography of the ET-1/AngII receptor polypeptide, immunocytochemical studies were done on intact (nonpermeabilized) CoslpMAM-ET-1/AngII transfectants utilizing a polyclonal antipeptide antibody raised against amino acids 51–60 of the predicted extracellular domain (Fig. 1). As shown in Fig. 3, prominent staining was observed in pMAM-ET-1/AngII transfectants (Fig. 3B). In contrast, the cells transfected with the parental expression vector, CoslpMAMneo, were not stained (Fig. 3A). These results corroborate the predicted topography and cell membrane localization of the ET-1/AngII receptor.

Fig. 3
figure 3

Immunocytochemical localization of the ET-1/AngII receptor in Cosl stable transfectants demonstrating predicted topography and localization to the cell membrane. (A) Control Cosl pMAMneo transfectants show minimal background staining. (B) CoslpMAM-ET-1/AngII transfectants show intense immunostaining with the polyclonal antipeptide antibody raised against the predicted extracellular peptide P51LLTSLGSKE60 (Fig. 1). Primary antibody was reacted with intact cells followed by immunostaining as described in Materials and Methods. Bar corresponds to 32 µM for A and B.

Full size image

Tissue Distribution of the ET-1/AngII Receptor mRNA

Analysis of the ET-1 / AngII receptor mRNA tissue distribution by Northern blot analysis (Fig. 4) revealed an approximately 4-kb mRNA prominently expressed in brain and heart tissues. Much lower but detectable levels can be observed in aorta, adrenal gland, and lung tissues. Northern analysis did not detect ET-1/AngII receptor sequences in kidney and liver. However, reverse transcriptase-polymerase chain amplification of 5′ untranslated RNA sequences could detect the ET-1/AngII mRNA in all tissues tested, including kidney and liver (data not shown).

Fig. 4
figure 4

Tissue distribution of the ET-1/AngII receptor mRNA. RNA blot analysis of different adult rat tissue total cellular RNAs (5 µg) is presented (A). Lane 1: kidney, lane 2: brain, lane 3: cardiac left ventricle, lane 4: cardiac right ventricle, lane 5: atria, lane 6: aorta, lane 7: adrenal gland, lane 8: lung, lane 9: liver. The RNA blot was hybridized to an ET-1/AngII receptor cDNA probe encompassing nucleotides 2520–3274 of the full-length cDNA (Fig. 1) as previously described (41). Nondegradation of RNA samples and relative amounts are directly documented in the ethidium-bromide picture presented in parallel (B). 28S and 18S ribosomal RNAs are marked by arrowheads.

Full size image

Site-Directed Mutagenesis of the ET-1 Binding Domain

In order to determine whether the putative ET-1 binding domain, as delineated by the homology to antisense peptide sequences (Fig. 1), indeed represents the structural determinants for ET-1 binding within the ET-1/AngII receptor, we performed mutational studies on the putative ET-1 binding domain while preserving the structure of the putative AngII binding domain. More specifically, our strategy involved modifying the ET-1 binding domain without affecting, or only minimally so, the AngII binding site which would serve as an ideal internal control for potential “unwanted conformation effects” of the mutagenesis directed towards the ET-1 binding domain. We therefore chose to replace R64 and W65, amino acids that contain the largest side chains among the naturally occurring amino acids, for glycine (G), an amino acid that contains the smallest side chain (hydrogen). Such drastic changes in size of the side chain at amino acid positions 64 and 65 were expected to have a prominent effect on the putative conformation of this peptide region with concomitant detrimental effect on ET-1 binding.

The results of the mutational studies (Fig. 5, Table 1) support the hypothesis that motif E60MKSRWNW67 is a structural determinant of ET-1 binding in the ET-1/AngII receptor. Substitution of R64 by glycine (R64G; Fig. 5C, D, Table 1) and substitution of W65 by glycine (W65G; Fig. 5E, F, Table 1) completely abrogate ET-1 binding without or minimally affecting AngII binding. It is noted that the R64G substitution did not affect AngII binding (Table 1), whereas W65G substitution decreased the AngII affinity by 5.7-fold (from wild-type KH of AngII = 1.30 ± 0.30 nmol/L to W65G KH AngII = 7.36 ± 1.50 nmol/L; Table 1).

Fig. 5
figure 5

Assessment of the predicted ET-1/AngII receptor ET-1 binding domain via site-directed mutagenesis. Saturation binding curves with 125I-AngII (A, C, E) and 125I-ET-1 (B, D, F) in the wild-type (W.T.) (A, B), R64G (C, D), and W65G (E, F) ET-1/AngII receptors expressed in permanent Cosl cell transfectants. Mutagenesis and binding studies were performed as described in Materials and Methods. Each curve is representative of at least three independent experiments performed in quadruplicate.

Full size image
Table 1 Binding parameters of wild-type and mutant ET-1/AngII receptors for AngII and ET-1 expressed in permanent Cosl cell transfectants
Full size table

Discussion

The elucidation of the ET-1/AngII receptor as a single transmembrane domain receptor is unique among AngII (11,23–27) and ET (28–30) seven-transmembrane domain G-protein-coupled receptors. The dual ET-1/AngII receptor is functionally coupled to a Ca2+-mobilizing transduction system, responding equivalently to both ET-1 and AngII in a highly specific manner. The ET-1 and AngII EC50 values of 7 pmol/L and 6 pmol/L, respectively, strongly suggest that this receptor is fully functional under normal physiological conditions as their respective EC50 values fall well within the range of normal circulating levels of respective peptide hormones (31,32). Interestingly, Sar1-Ala8-AngII (AngII-specific antagonist) blocked both the AngII- and ET-l-induced Ca2+ response (Fig. 2B). The molecular mechanism involved in the inhibition of the ET-1 response by the AngII-specific inhibitor, Sar1-Ala8-AngII, most likely involves inhibition of ET-l-induced receptor conformational transition necessary to activate the downstream transducing system effected by ET-1 since neither AngII (Fig. 2E) nor Sar1-Ala8-AngII (data not shown) were able to displace 125I-ET-1-specific binding.

ET-1 and AngII can evoke a number of similar responses in different organ systems (33). The existence of the dual ET-1/AngII receptor could partially explain these observations. Recently, it has been reported that both ET-1 and AngII stimulated fibronectin and type IV collagen mRNA expression and mitogenesis in rat mesangial cells (34). Unexpectedly, Losartan (a specific AT1 receptor antagonist) inhibited the ET-1-mediated effects whereas BQ-123 (a specific ETA receptor antagonist) inhibited the AngII-induced fibronectin synthesis and mesangial cell proliferation (34). These data could well be explained by the presence and mediation of these physiologic responses by the ET-1/AngII receptor in rat mesangial cells. The inhibition of ET-1-mediated responses by Losartan (34) resembles the inhibition of ET-l-induced Ca2+ mobilization by Sar1-Ala8-AngII noted above (Fig. 2B). We have detected ET-1/AngII receptor mRNA in kidney; however, its existence in mesangial cells remains to be determined.

Our results demonstrate that the motif E60MKSRWNW67 is necessary for ET-1 binding to the ET-1/AngII receptor. This is in contrast with previous structure-functional studies in which extensive regions within endothelin receptors spanning extracellular, transmembrane, and intracellular portions of the receptor have been invoked to be involved in endothelin binding (35–37). These studies, however, did not exclude the possibility of conformational effects induced by the mutagenic changes because of the lack of “internal control” that could account for induced conformational/allosteric effects. It is interesting to note that the antisense peptide delineating the ET-1 binding domain encompasses the carboxyl-terminal 8 amino acids of the ET-1 peptide, thus indicating that these 8 residues most likely represent the motif within ET-1 that interact with the ET-1/AngII receptor. This is consistent with previous observations implicating the carboxyl-terminal domain of endothelin peptides in their binding to their corresponding receptors (38–40), respectively.

The isolation and characterization of the ET-1/AngII receptor elucidates a new paradigm involved in the evolution of hormone-binding domains in different receptors, thus refining a principle of the molecular recognition theory. The data presented above identified the antisense peptides from frames 2 and 3 as the related evolutionary precursor binding domains for ET-1 and AngII, respectively, in the ET-1/AngII receptor (Fig. 1). On the other hand, the antisense peptides in frame 1 for both AngII and AVP were delineated as the corresponding precursor binding domains within the AngII/AVP receptor (11). These findings suggest that antisense peptides originating from the three possible frames can be used as potential precursor binding domains in the evolutionary pathway of different isoreceptors. This intrinsic property of derived antisense peptides probably had a significant impact in the evolution of peptide hormone-cognate receptor systems by effectively increasing the possibility of producing putative cognate receptors. We anticipate that as more molecular genetic, physicochemical, and crystallographic evidence accumulates in the near future, a more complete understanding of the evolution and principles underlying peptide and protein-protein interaction will emerge, thus opening a window into a fundamental organizational principle that governs structure and function in living cells.

References

  1. Blalock JE. (1995) Genetic origins of protein shape and interaction rules. Nature Med. 1: 876–878.

    Article  CAS  PubMed  Google Scholar 

  2. Bost KL, Smith EM, Blalock JE. (1985) Similarity between the corticotropin (ACTH) receptor and a peptide encoded by an RNA that is complementary to ACTH mRNA Proc. Natl. Acad. Sci. U.S.A. 82: 1372–1375.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. De Souza SJ, Brentani R. (1992) Collagen binding site in collagenase can be determined using the concept of sense-antisense peptide interactions. J. Biol. Chem. 267: 13763–13767.

    PubMed  Google Scholar 

  4. Baranyi L, Campbell W, Ohshima K, Fujimoto S, Boros M, Okada H. (1995) The antisense homology box: A new motif within proteins that encodes biologically active peptides. Nature Med. 1: 894–901.

    Article  CAS  PubMed  Google Scholar 

  5. Martins VR, Graner E, Garcia-Abreu J, et al. (1997) Complementary hydropathy identifies a cellular prion protein receptor. Nature Med. 3: 1376–1382.

    Article  CAS  PubMed  Google Scholar 

  6. Rasmussen UB, Hesch RD. (1987) On antisense peptides: The parathyroid hormone as an experimental example and a critical theoretical view. Biochem. Biophys. Res. Commun. 149: 930–938.

    Article  CAS  PubMed  Google Scholar 

  7. de Gasparo M, Whitebread S, Einsle K, Heusser C. (1989) Are the antibodies to a peptide complementary to angiotensin n useful to isolate the angiotensin II receptor? Biochem. J. 261: 310–311.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Golstein A, Brutlag DL. (1989) Is there a relationship between DNA sequences encoding peptide ligands and their receptors? Proc. Natl. Acad. Sci. U.S.A. 86: 42–45.

    Article  Google Scholar 

  9. Kelly JM, Trinder D, Phillips PA, et al. (1990) Vasopressin antisense peptide interactions with the VI receptor. Peptides 11: 857–862.

    Article  CAS  PubMed  Google Scholar 

  10. Jurzak M, Pavo I, Fahrenholz F. (1993) Lack of interaction of vasopressin with its antisense peptides: A functional and immunological study. J. Recept. Res. 13: 881–902.

    Article  CAS  PubMed  Google Scholar 

  11. Ruiz-Opazo N, Akimoto K, Herrera VLM. (1995) Identification of a novel dual angiotensin II/vasopressin receptor on the basis of molecular recognition theory. Nature Med. 1: 1074–1081.

    Article  CAS  PubMed  Google Scholar 

  12. Yanagisawa M, Kurihara H, Kimura S, et al. (1988) A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 332: 411–415.

    Article  CAS  PubMed  Google Scholar 

  13. Ohkubo H, Kageyama R, Ujihara M, Hirose T, Inayama I, Nakanishi S. (1983) Cloning and sequence analysis of cDNA for rat angiotensinogen. Proc. Natl. Acad. Sci. U.S.A. 80: 2196–2200.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Brown RD, Berger KD, Taylor P. (1984) α1-adrenergic receptor activation mobilizes cellular Ca++ in a muscle cell line. J. Biol. Chem. 259: 7554–7562.

    PubMed  CAS  Google Scholar 

  15. Kyte J, Doolittle RF. (1982) A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132.

    Article  CAS  PubMed  Google Scholar 

  16. Engelman DM, Steitz TA, Goldman A. (1986) Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu. Rev. Biophys. Biophys. Chem. 15: 321–353.

    Article  CAS  PubMed  Google Scholar 

  17. Adams GA, Rose JK. (1985) Structural requirements of a membrane-spanning domain for protein anchoring and cell surface transport. Cell 41: 1007–1015.

    Article  CAS  PubMed  Google Scholar 

  18. Kemp BE, Pearson RB. (1990) Protein kinase recognition sequence motifs. Trends Biochem. Sci. 15: 342–346.

    Article  CAS  PubMed  Google Scholar 

  19. Lytle C, Forbush B 3d. (1992) The Na, K, Cl-co-transport protein of shark rectal gland. II. Regulation by direct phosphorylation. J. Biol. Chem. 267: 25438–25443.

    PubMed  CAS  Google Scholar 

  20. Trowbridge IS. (1991) Endocytosis and signals for internalization. Curr. Opin. Cell Biol. 3: 634–641.

    Article  CAS  PubMed  Google Scholar 

  21. Peters C, Braun M, Weber B, et al. (1990) Targeting of a lysosomal membrane protein: A tyrosinecontaining endocytosis signal in the cytoplasmic tail of lysosomal acid phosphatase is necessary and sufficient for targeting to lysosomes. EMBO J. 9: 3497–3506.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  22. Simonson MS, Dunn MJ. (1990) Cellular signaling by peptides of the endothelin gene family. FASEB J. 4: 2989–3000.

    Article  CAS  PubMed  Google Scholar 

  23. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE. (1991) Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 35: 233–236.

    Article  Google Scholar 

  24. Sasaki K, Yamano Y, Bardhan S, et al. (1991) Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature 351: 230–233.

    Article  CAS  PubMed  Google Scholar 

  25. Sanberg K, Ji H, Clark AJL, Shapira H, Catt KJ. (1992) Cloning and expression of a novel angiotensin II receptor subtype. J. Biol. Chem. 267: 9455–9458.

    Google Scholar 

  26. Kambayashi Y, Bardhan S, Takahashi K, et al. (1993) Molecular cloning of a novel angiotensin II receptor isoform involved in phosphotyrosine phosphatase inhibition. J. Biol. Chem. 268: 24543–24546.

    PubMed  CAS  Google Scholar 

  27. Mukoyama M, Nakajima M, Horiuchi M, Sasamura H, Pratt RE, Dzau VJ. (1993) Expression cloning of the type 2 angiotensin II receptor reveals a unique class of seven-transmembrane receptor. J. Biol. Chem. 268: 5439–5442.

    Google Scholar 

  28. Sakurai T, Yanagisawa M, Takuwa Y, et al. (1990) Cloning of a cDNA encoding a nonisopeptide-selective subtype of the endothelin receptor. Nature 348: 732–735.

    Article  CAS  PubMed  Google Scholar 

  29. Lin HY, Kaji EH, Winkel GK, Ives HE, Lodish HF. (1991) Cloning and functional expression of a vascular smooth muscle endothelin-1 receptor. Proc. Natl. Acad. Sci. U.S.A. 88: 3185–3189.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Karne S, Jayawickreme CK, Lerner MR. (1993) Cloning and characterization of an endothelin-3 specific receptor (Etc receptor) from Xenopus laevis dermal membranes. J. Biol. Chem. 268: 19126–19133.

    PubMed  CAS  Google Scholar 

  31. Powell-Jackson JD, MacGregor J. (1976) Radioimmunoassay of angiotensin II in the rat. J. Endocrinol. 68: 175–176.

    Article  CAS  PubMed  Google Scholar 

  32. Battistini B, D’Orleans-Juste P, Sirois P. (1993) Endothelins: circulating plasma levels and presence in other biologic fluids. Lab. Invest. 68: 600–628.

    PubMed  CAS  Google Scholar 

  33. Egido J. (1996) Vasoactive hormones and renal sclerosis: Nephrology forum. Kidney Int. 49: 578–597.

    Article  CAS  PubMed  Google Scholar 

  34. Gomez-Garre D, Ruiz-Ortega M, Ortego M, et al. (1996) Effects and interactions of endothelin-1 and angiotensin II on matrix protein expression and synthesis and mesangial cell growth. Hypertension 27: 885–892.

    Article  CAS  PubMed  Google Scholar 

  35. Hashido K, Gamou T, Adachi M, et al. (1992) Truncation or N-terminal extracellular of C-terminal intracellular domains of human ETA receptor abrogated the binding activity of ET-1. Biochem. Biophys. Res. Commun. 187: 1241–1248.

    Article  CAS  PubMed  Google Scholar 

  36. Adachi M, Yang Y, Trezciak A, Furuichi Y, Miyamoto C. (1992) Identification of a domain of ETA receptor required for ligand binding. FEBS Lett. 311: 179–183.

    Article  CAS  PubMed  Google Scholar 

  37. Hashido K, Adachi M, Gamou T, Watanabe T, Furuichi Y, Miyamoto C. (1993) Identification of specific intracellular domains of the human ETA receptor required for ligand binding and signal transduction. Cell. Mol. Biol. Res. 39: 3–12.

    PubMed  CAS  Google Scholar 

  38. Kimura S, Kasuya Y, Sawamura T, et al. (1988) Structure-activity relationships of endothelin: Importance of C-terminal moiety. Biochem. Biophys. Res. Commun. 156: 1182–1186.

    Article  CAS  PubMed  Google Scholar 

  39. Maggi CA, Giuliani S, Patacchini R, et al. (1989) The C-terminal hexapeptide, endothelin-(16–21), discriminates between different endothelin receptors. Eur. J. Pharmacol. 166: 121–122.

    Article  CAS  PubMed  Google Scholar 

  40. Takai M, Umemura I, Yamasaki K, et al. (1992) A potent and specific agonist, Suc-[Glu9, Alall, 15]-endothelin-1(8–21), IRL 1620, for the ETB receptor. Biochem. Biophys. Res. Commun. 184: 953–959.

    Article  CAS  PubMed  Google Scholar 

  41. Herrera VLM, Chobanian AV, Ruiz-Opazo N. (1988) Isoform-specific modulation of Na+, K+-ATPase α-subunit gene expression in hypertension. Science 241: 221–223.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgments

We thank Dr. Joan Keiser (Parke-Davis) for providing us with PD123319, Dr. Ronald D. Smith (Dupont Merck) for providing us with Losartan potassium, and A. Tsikoudakis for preparation of the graphs and manuscript.

Author information

Authors and Affiliations

  1. Section of Molecular Genetics, W-609, Whitaker Cardiovascular Institute, Boston University School of Medicine, 700 Albany Street, Boston, Massachusetts, 02118, USA

    Nelson Ruiz-Opazo, Kenji Hirayama, Kaoru Akimoto & Victoria L. M. Herrera

  2. Section of Cardiology, Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA

    Victoria L. M. Herrera

Authors
  1. Nelson Ruiz-Opazo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Kenji Hirayama
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Kaoru Akimoto
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Victoria L. M. Herrera
    View author publications

    You can also search for this author in PubMed Google Scholar

Additional information

Communicated by S. H. Orkin.

Rights and permissions

Reprints and permissions

About this article

Cite this article

Ruiz-Opazo, N., Hirayama, K., Akimoto, K. et al. Molecular Characterization of a Dual Endothelin-1/Angiotensin II Receptor. Mol Med 4, 96–108 (1998). https://doi.org/10.1007/BF03401733

Download citation

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/BF03401733

Keywords

Molecular Medicine

ISSN: 1528-3658