Skip to main content
Download PDF
  • Original Articles
  • Published:

Association Between HLA DQBl * 03 and Cervical Intra-epithelial Neoplasia

Molecular Medicine volume 1, pages 161–171 (1995)Cite this article

Abstract

Background

Cervical intraepithelial neoplasia (CIN) and cervical cancer have been shown to be strongly associated with infection by human papillomavirus (HPV). However, other factors may be contributory in the progression from normal epithelium to CIN and cervical cancer, since not all women with HPV infection develop disease. Recently, it was demonstrated that there is a high risk for cervical cancer and CIN in women with HLA DQB1 * 03 (RR = 7.1, p < 0.0009) (1). Subsequent reports have been conflicting, due to sample size, genetic heterogeneity and differences in the techniques employed for the detection of HLA DQB1 * 03.

Materials and Methods

DNA from cervical smears of 178 women with CIN and 420 controls with normal cervical cytology was analyzed by polymerase chain reaction (PCR) with type-specific primers for HPV 16, 18, 31, and 33. The DNA from test and control samples were also analyzed by a novel PCR technique, which mutates the first base of codon 40 (DQ alleles) from T to G to create an artificial restriction site for an enzyme Mlu I that distinguish DQB1 * 03 from other alleles and are confirmed by digestion of amplified DNA with Mlu I. Further analysis of individual DQB1 * 03 alleles was performed using PCR and allele-specific primers.

Results

One hundred forty-four (34%) out of 420 controls (all HPV 16, 18, 31, or 33 negative and normal cytology), 37/66 (56%) of CIN I and 72/112 (64%) of CIN III were positive for DQB1 * 03 (trend test, p < 0.001, χ2 = 37.3). A significant association was observed between DQB1 * 03 and CIN (odds ratio 3.03; 95% CI 2.11–3.45). Of women with CIN, 131/ 178 (73.5%) had HPV (types 16, 18, 31, or 33) infection. There was a significant association between DQB1 * 03 and presence of HPV (odds ratio 3.43; 95% CI 2.25–5.10). Homozygosity for DQB1 * 03 was more strongly associated with CIN than heterozygosity (odds ratios 4.0 and 2.63, respectively); and for the presence of HPV (odds ratio 4.47; 95% CI 2.58–7.77). HLA DQB1 * 0301 was the most strongly associated allele with CIN and HPV (odds ratios 2.53 and 2.63, respectively).

Conclusions

HLA DQB1 * 03 is associated significantly with CIN and may be permissive for HPV infection. Further analysis of class II HLA typing in CIN is necessary to evaluate this association.

Introduction

The hypothesis that human papillomavirus (HPV) is causally associated with cervical intraepithelial neoplasia (CIN) and cervical cancer is well supported by several lines of evidence. First, HPV is detected in the cervical tissue of majority of patients with disease, compared with controls (2, 3). Second, the oncogenic types of HPV can transform and immortalize human keratinocytes in vitro (4, 5). Third, the HPV16 E6 and E7 proteins inactivate endogenous tumour suppressor proteins p53 and Rb, thereby abrogating normal cell control mechanisms (6). Despite this, the majority of women infected with HPV do not develop CIN or cancer. Several cofactors have been suggested as being important. A recent analysis of HLA type has shown a significant association between HLA class II, in particular HLA DQB1 * 03, and cervical cancer but not for class I (1). Subsequent reports have not been consistent (Table 1) presumably due to the size and type of population examined and differences in techniques used for the HLA and HPV typing. As cervical intraepithelial neoplasia (CIN) is an early stage prior to the development of cervical cancer, any association with HLA class II that could be demonstrated would be important. This paper reports the results of such a study conducted in a Caucasian population, where both controls and test samples were typed for HPV and HLA DQB1 * 03.

Table 1 Summary of studies on CIN, cervical cancer, and HLA
Full size table

Materials and Methods

Sample Collection

Cervical smears were taken using standard procedures from healthy women and those with CIN attending the outpatient clinics at City Hospital, Nottingham; Whittington Hospital, London, and the Margaret Pyke center, London. Further processing of samples for PCR was performed as described (7, 8).

Histological Diagnosis

Histological classification into the three groups of normal, CIN I, and CIN III were carried out according to established criteria (9, 10).

HPV Typing

HPV typing by PCR was performed using type specific oligonucleotide primers (HPV 16, 18, 31, 33) as previously described. (7, 8)

HLA Typing

A rapid system to type the HLA DQB1 * 03 was developed using primer directed mutagenesis by PCR and restriction enzyme digestion (artificial restriction fragment lenth polymorphism [ARFLP]-PCR) (11). All DQB1 * 03 alleles possess an A as the last base of codon 38 followed by CGC (codon 39) and TTC (codon 40) (Fig. 1). By mutating the first base of codon 40, from “T” to “G”, a Mlu I site (ACGCGT) is created in the DQB1 * 03 allele. Non DQB1 * 03 alleles possess a “G” as the last base of codon 38, and a Mlu I site cannot be created this way. The forward primer A is used in conjunction with the reverse mutagenesis primer B:

Fig. 1
figure 1

A schematic diagram showing the principle of ARFLP-PCR

Full size image
$$\begin{array}{*{20}{c}} {A:\;5'\;AGGATCCCCGCAGAGGATTTCGTGTACC\;\;3'\;(forward)\;\;\;} \\ {B:\;5'\;CCGGTACACCCCCACGTCGCTGTCGACGCG\;\;3'\;(reverse)} \end{array}$$

(The mutated base is underlined.) PCR was carried out as described in 50 vl volume using a Techne-PC 3 machine, according to manufacturer’s instructions. The initial denaturation was at 94°C for 8 min followed by 30 cycles each at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min. There was a final extension step at 72°C for 15 min.

Following amplification 10 µl of the PCR product was restricted with 50 units of Mlu I (Boehringer Mannheim) in a volume of 20 µl at 37°C overnight using manufacturer’s buffer. The products were analyzed by electrophoresis on 4% agarose gels (Metaphor, Flowgen) (Fig. 2).

Fig. 2
figure 2

A 4% agarose gel showing amplified DNA after PCR with primers A and B with and without digestion by Mlu I

The size of amplified DNA is 145 bp and on digestion with Mlu I, a 115 and 30 bp product is produced in DQB1 * 03 homozygotes. DNA for all controls were from the British Society for Histocompatibilty and Immunogenetics. Arrows show the 145 and 115 bp products. (Lanes 2 and 3) Heterozygous DQB1 * 03 control with and without digestion by Mlu I. (Lanes 4 and 5) Homozygous DQB1 * 03 control with and without digestion with Mlu I. (Lanes 6 and 7) Non-DQB1 * 03 control with and without digestion with Mlu I. (Lanes 1 and 8) 123 bp markers.

Full size image

Further typing for HLA DQB1 * 03 for 0301, 0302, 0303, and 0304 in samples that were positive for the HLA DQB1 * 03 phenotype was performed by PCR using a combination of sequence specific primers (12) (Table 2). The annealing temperature for all the primer pairs was 60°C, and other PCR conditions were as published (12). All PCR reactions were performed with both positive and negative controls. The amplified products were separated by agarose gel electrophoresis and visualized by ultraviolet (UV) light.

Table 2 Sequence-specific primer pairs for typing the HLA DQB1 * 03 locus
Full size table

Statistical Analysis

Odds ratios and their approximate 95% confidence intervals were calculated for all variables by a χ2 test for 2 x 2 tables without a continuity correction (13). For 2 x k tables the χ2 test for trend was calculated (14). The unit of sampling was the individual in all analysis except when studying specific alleles. In that case, each allele was taken as an independent observation so that the sample size was twice as large for allele specific comparisons.

Results

Overall (Table 3)

Table 3 Summary of distribution of HLA DQB1 * 03
Full size table

Association Between HLA DQB1 * 03 and CIN (Tables 4 and 5).

Table 4 Association between HLA DQB1 * 03 and CIN
Full size table
Table 5 Association between HLA DQB1 * 03 allele and CIN
Full size table

Association Between HPV and HLA DQB1 * 03 (Tables 6, 7, and 8).

Table 6 Association between HLA DQB1 * 03 and HPV type
Full size table
Table 7 Association between HLA DQBI * 03 and HPV
Full size table
Table 8 Association between HLA DQB1 * 03 allele and HPV
Full size table

Discussion

Cancer of the uterine cervix is the second most common cancer world-wide and the most common cancer in developing countries (15). The annual incidence in the UK is 4,000 cases per year, with 2,000 dying as a result of the disease. Cervical intraepithelial neoplasia which precedes cervical cancer is even more common. Both cervical cancer and CIN have been shown to be strongly associated with the oncogenic types of the human papillomaviruses (types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, and 58) (16, 17). An overview of studies show that the incidence of HPV infection detected by PCR based techniques in women with normal cervical cytology varies from 6–53% (18). There also exists a long latency period between HPV infection and cervical cancer (19). Therefore, additional factors are probably involved in the transformation of normal epithelium to CIN and cervical cancer after HPV infection. One such factor is possibly immunological, as in other virus induced cancers, such as nasopharyngeal carcinoma due to Epstein-Barr virus (20). In immunocompromised women following renal transplantation, the risk for cervical cancer is increased 10 fold (21). HIV infected patients also show an increased frequency of CIN (22). Analysis of HLA class I and II antigens in cervical cancer has shown that loss of class I expression occurs in a third of patients, while the majority demonstrated increased class II expression (23, 24).

HLA type has been analyzed by several groups in patients with cervical cancer and CIN with different conclusions (Table 1). The discrepancy in the results between different investigators maybe due to several reasons. Serological typing of DQB1, as in the initial report, is prone to significant error (25). The sample size was adequate in only two studies (26, 27). In fact, analysis on a sufficiently large number of cases of CIN has not been performed, though two preliminary studies reported that the DQB1 * 03 locus was associated significantly with CIN (Table 1) (28, 29). The controls in several studies were from local donor panels and not necessarily comparable. Typing for HPV was performed in only three studies (27, 30, 31). To address these issues we have performed a larger study with sufficient number of cases and controls to evaluate the significance of DQBI * 03 association with cervical intraepithelial neoplasia. Further, it is quite important to evaluate the association between CIN, HPV, and DQBI * 03 using controls that are negative for HPV and have a normal cytology.

The typing for HLA DQB1 * 03 was performed with a rapid technique which was concordant with data based on sequencing (11). This technique is also informative in assessing whether the individual sample is heterozygous or homozygous for the DQB1 * 03 locus. The results show a significant association between CIN and DQB1 * 03 which is only slightly stronger for CIN III than CIN I. The association between CIN and DQB1 * 03 that we found (odds ratio 3.03) was weaker than that reported by Wank and Thomssen (1). A slightly stronger association in HPV-positive CIN (odds ratio 3.43) was observed than that reported by Van den velde et al. (28). Homozygosity at the DQB1 * 03 locus, was significantly associated (odds ratio 4.0) with CIN and was more strongly related than heterozygosity, a result not reported so far in any of the previous studies. The 0301 allele was the most strongly associated with CIN (odds ratio 2.53, χ2 = 28.6, p < 0.001), but 0302 was also positively related. This agrees with Wank and Thomssen’s DNA typing data for 0301 on their original sample of cervical cancer patients (32). A significant association with HPV-positive CIN and DQB1 * 03 was found for all HPV types tested (types 16, 18, 31, and 33). Again, homozygosity at the DQB1 * 03 locus was strongly associated with HPV-positive CIN (odds ratio 4.47) with intermediate risk found for heterozygotes. Typing for HPV has not always been performed in all the previous studies, but in general HPV-positive CIN was significantly associated with the DQB1 * 03 phenotype. In our study, only the most prevalent oncogenic types have been determined, and it is possible that some of the HPV-negative CIN cases are positive for other types. Additional typing for other HPV types would probably increase the strength of the association. These results suggest that the DQB1 * 03 locus is probably an important determinant in allowing HPV infection to be tolerated and increasing the risk for high grade CIN or cancer.

Another disease due to HPV infection, recurrent respiratory papillomatosis, has been shown to be associated with the DQB1 * 03 phenotype (33). In a preliminary analysis of 16 patients, 75% were positive for DQB1 * 03. Analysis of HLA class I and II using restriction fragment length polymorphism’s in New Zealand rabbits infected with Shopecotton-tail rabbit papillomavirus showed a strong linkage between wart regression and DR locus, and an increased risk of malignant transformation with the DQ locus (34). Thus, based on our study and others, the DQB1 * 03 locus seems to be important for HPV associated disease. The results of the analysis of HLA DR and DQ in squamous cell carcinoma reported by Apple et al. (27) in an Hispanic population are intriguing in that no significant association was found with the DQB1 * 03 locus, although the haplotype DRB1 * 0407-DQB1 * 0302 was associated with increased risk of cervical carcinoma. It may be partly related to ethnicity of the population under study.

There are at least three possible ways by which the association between DQB1 * 03 and HPV positive disease can be explained. These women may present peptide antigen to CD4+ T cells ineffectively; clonal deletion of antigen specific T cell during thymic maturation may occur; or there maybe active suppression of immune response to HPV in DQB1 * 03 positive women. Although Mellins et al. (35) using T cell lines and specific HLA DP, DQ, and DR deletion mutants have shown that 20–30% of response to various recall antigens is restricted to DQ, in general, there is a bias against HLA-DQ restriction in human T cell clones reflecting a low level of expression of DQ on antigen presenting cells in the periphery (36). One proposal, in view of the above result, is that DQ is important in thymic selection of T cells. Indeed, there is a high level of expression of HLA DQ in the thymic cortex (37), and a role for negative selection for HPV-specific T cell clones would fit predisposition to HPV-positive CIN by the DQB1 * 03 alleles. The other possible mechanism is based on observations of HLA-associated immunological low responsiveness to antigens such as streptococcal cell wall (38), schistosoma (39), mycobaterium leprae (40), tetanus toxoid (41), and hepatitis surface antigen (42) either after natural exposure or after vaccination. Despite the controversy regarding the function of suppressor T cells, there is evidence to suggest that HLA DQ maybe the preferred restriction element for immunological suppression mediated by CD8-positive T suppressor cells (43, 44). It is possible that women who are positive for the DQB1 * 03 phenotype are unable to mount an effective cytotoxic T cell response against HPV infection. This is particularly important as it has been shown that HPV 16 E7 is a target for cytotoxic T cells and can mediate tumor rejection (45).

The present study on CIN lays the framework for a more detailed study of DR and DQ in CIN to identify the significant haplotype. It is obvious that detailed investigation of mechanisms of HLA association with CIN would be important in improving the understanding of the biology of cervical cancer and generally be informative about virus associated cancer. This has obvious importance in the design of vaccines for prevention and treatment of HPV infection and associated disease.

References

  1. Wank R, Thomssen C. (1991) High risk of squamous cell carcinoma of the cervix for women with HLA-DQw3. Nature 352: 723–725.

    Article  CAS  PubMed  Google Scholar 

  2. Meijer CJLM, van den Brule AJC, Snijders PJF, Heimerhorst T, Kenemans P, Walboomers JMM. (1992) Detection of human papillomavirus in cervical scrapes by the polymerase chain reaction in relation to cytology: Possible implications for cervical cancer screening. In: Munoz N, Bosch FX, Shah KV, Meheus A (eds). The Epidemiology of Human Papillomavirus and Cervical Cancer. Oxford University Press, Oxford.

    Google Scholar 

  3. Lorincz AT, Reid R, Jenson B, Greenberg MD, Lancaster W, Kurman RJ. (1992) Human papillomavirus infection of the cervix: relative risk association of 15 common anogenital types. Obstet. Gynecol. 79: 328–337.

    Article  CAS  PubMed  Google Scholar 

  4. Hawley-Nelson P, Vousden KH, Hubbert NL, Lowy DR, Schiller JT. (1989) HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. E.M.B.O. J. 8: 3905–3910.

    CAS  Google Scholar 

  5. Munger K, Phelps WC, Bubb V, Howley PM, Schlegel RM. (1989) The E6 and E7 genes of human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. J. Virol. 63: 4417–4421.

    PubMed  PubMed Central  CAS  Google Scholar 

  6. Vousden KH. (1993) Interactions of human papillomavirus transforming proteins with the products of tumour suppresor genes. F.A.S.E.B. J. 7: 872–879.

    CAS  Google Scholar 

  7. Cuzick J, Terry G, Ho L, Hollingworth T, Anderson M. (1992) Human papillomavirus type 16 DNA in cervical smears as a predictor of high-grade cervical intraepithelial neoplasia. Lancet 339: 959–960.

    Article  CAS  PubMed  Google Scholar 

  8. Cuzick J, Terry G, Ho L, Hollingworth T, Anderson M. (1994) Type-specific human papillomavirus DNA in abnormal smears as a predictor of high-grade cervical intraepithelial neoplasia. Br. J. Cancer 69: 167–171.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Richart RM. (1987) Causes and management of cervical intraepithelial neoplasia. Cancer 60: 1951–1959.

    Article  CAS  PubMed  Google Scholar 

  10. Anderson M, Brown C, Buckley C, et al. (1991) Current views on cervical intraepithelial neoplasia. J. Clin. Pathol. 44: 969–978.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Mehal WZ, Lo YD, Herrington S, et al. (in press) Human papillomavirus infection plays an important role in determining the HLA associated risk of cervical carcinogenesis. J. Clin. Pathol.

  12. Olerup O, Aldener A, Fogdell A. (1993) HLA-DQB1 and -DQA1 typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Tissue Antigens 41: 119–134.

    Article  CAS  PubMed  Google Scholar 

  13. Davis W, Breslow NE Day NE (eds). (1980) Statistical Methods in Cancer Research: vol.1: The analysis of case control studies. International Agency for Research on Cancer, Lyon.

    Google Scholar 

  14. Armitage P (ed). (1971) Statistical Methods in Medical Research. Blackwell, Oxford.

    Google Scholar 

  15. Parkin DM, Laara E, Muir CS. (1988) Estimates of the worldwide frequency of sixteen major cancers in 1980. Int. J. Cancer 41: 184–197.

    Article  CAS  PubMed  Google Scholar 

  16. Schiffman MH, Bauer HM, Hoover RN, et al. (1993) Epidemiologic evidence showing that human papillomavirus infection causes most cervical intraepithelial neoplasia. J. Natl. Cancer Inst. 85: 958–964.

    Article  CAS  PubMed  Google Scholar 

  17. Walboomers J, Melkert P, van den Brule A, Snijders P, Meijer C. (1992) The polymerase chain reaction for screening in diagnostic cytopathology of the cervix. In: Herrington CS, McGee JO (eds). Diagnostic Molecular Pathology. IRL press, Oxford.

    Google Scholar 

  18. Schneider A, Koutsky L. (1992) Natural history and epidemiological features of genital HPV infection. In: Munoz M, Bosch FX, Shah KV, Meheus A (eds). The Epidemiology of Cervical Cancer and Human Papillomavirus. International Agency for Research on Cancer, Lyon.

    Google Scholar 

  19. Zur Hausen H. (1986) Intracellular surveillance of persisting viral infections. Lancet 1: 489–491.

    Article  Google Scholar 

  20. Zur Hausen H. (1991) Viruses in human cancers. Science 254: 1167–1173.

    Article  PubMed  Google Scholar 

  21. Sillman FH, Sedlis A. (1987) Anogenital papillomavirus infection and neoplasia in immunodeficient women. In: Reed R (ed). Human Papillomavirus. W. B. Saunders, Philadelphia.

    Google Scholar 

  22. Schafer A, Friemann W, Mielke M, Schwatlander B, Koch MA. (1991) The increased frequency of cervical dysplasia in women infected with the human immunodeficiency virus is related to the degree of immunosuppression. Am. J. Obstet. Gynecol. 164: 593–599.

    Article  CAS  PubMed  Google Scholar 

  23. Connor MF, Stern PL. (1990) Loss of MHC class I expression in cervical carcinomas. Int. J. Cancer 46: 1029–1034.

    Article  CAS  PubMed  Google Scholar 

  24. Glew SS, Duggan-Keen M, Cabrera T, Stern PL. (1992) HLA class II antigen expression in human papillomavirus-associated cervical cancer. Cancer Res. 52: 4009–4016.

    PubMed  CAS  Google Scholar 

  25. Mytilineos J, Scherer S, Opelz G. (1990) Comparison of RFLP-DR-Beta and serological HLA-DR typing in 1500 individuals. Transplantation 50: 870–873.

    Article  CAS  PubMed  Google Scholar 

  26. Heiland A, Borresen AL, Kaern J, Ronningen KS, Thorsby E. (1992) HLA antigens and cervical carcinoma. Nature 356: 23.

    Article  Google Scholar 

  27. Apple RJ, Erlich HA, Klitz W, Manos MM, Becker TM, Wheeler CM. (1992) HLA DR-DQ associations with cervical carcinoma show papilloma virus-type specificity. Nature Gen. 6: 157–162.

    Article  Google Scholar 

  28. Vandenvelde C, deFoor M, vanBeers D. (1993) HLA-DQB1 * 03 and cervical intraepithelial neoplasia grades I–III. Lancet 341: 442–444.

    Article  CAS  PubMed  Google Scholar 

  29. David ALM, Taylor GM, Gokhale D, Aplin JD, Seif MW, Tindall VR. (1992) HLA-DQB1 * 03 and cervical intraepithelial neoplasia type III. Lancet 340: 52.

    Article  CAS  PubMed  Google Scholar 

  30. Glew SS, Duggan-Keen M, Ghosh AK, et al. (1993) Lack of association of HLA polymorphisms with human papillomavirus-related cervical cancer. Hum. Immunol. 37: 157–164.

    Article  CAS  PubMed  Google Scholar 

  31. Gregoire L, Lawrence WD, Kukuruga D, Eisenbrey AB, Lancester WD. (1994) Association between HLA-DQB1 alleles and risk for cervical cancer in African-American women. Int. J. Cancer 57: 504–507.

    Article  CAS  PubMed  Google Scholar 

  32. Wank R, Meulen JT, Luande J, Eberhardt H-C, Pawlita M. (1993) Cervical intraepithelial neoplasia, cervical carcinoma, and risk for patients with HLA-DQB1 * 0602, *301, *0303 alleles. Lancet 341: 1215.

    Article  CAS  PubMed  Google Scholar 

  33. Bonagura VR, O’Reilly ME, Abramson AL, Steinberg BM. (1993) Recurrent respiratory papillomatosis (RRP): Enriched HLA DQw3 phenotype and decreased class I MHC expression. Proceedings of the 12th International Papillomavirus Conference. p. 48.

  34. Han R, Breitburd F, Marche PN, Orth G. (1992) Linkage of regression and malignant conversion of rabbit viral papillomas to MHC class II genes. Nature 356: 66–68.

    Article  CAS  PubMed  Google Scholar 

  35. Mellins E, Woefel M, Pious D. (1987) Importance of HLA-DQ and HLA-DP restriction elements in T-cell responses to soluble antigens—Mutational analysis. Hum. Immunol 18: 211–213.

    Article  CAS  PubMed  Google Scholar 

  36. Altman DM, Sansom D, Marsh SGE. (1991) What is the basis for HLA-DQ associations with autoimmune disease? Immunol. Today 12: 267–270.

    Article  Google Scholar 

  37. Ishikura H, Ishikawa N, Aizawa M. (1987) Differential expression of HLA class H antigens in the human thymus-relative paucity of HLA-DQ antigens in the thymic medulla. Transplantation 44: 314–317.

    Article  CAS  PubMed  Google Scholar 

  38. Nishimura Y, Sasazuki T. (1983) Suppressor T cells control the HLA-linked low responsiveness to streptococcal antigen in man. Nature 301: 67.

    Article  Google Scholar 

  39. Sasazuki T, Ohta N, Kaneoka R, Kojima S. (1980) Association between an HLA haplotype and low responsiveness to schistosomal worm antigen in man. J. Exp. Med. 152: 314.

    Google Scholar 

  40. Ottenhoff THM, Walford C, Nishimura Y, Reddy NBB, Sasazuki T. (1990) HLA DQ molecules and the control of mycobaterium leprae specific T cell non responsiveness in lepromatous leprosy patients. Eur. J. Immunol. 20: 2347.

    Article  CAS  PubMed  Google Scholar 

  41. Sasazuki T, Kohno Y, Iwamoto I, Tanimura M, Naito S. (1978) Association between an HLA haplotype and low responsiveness to tetanus toxoid in man. Nature 272: 359.

    Article  CAS  PubMed  Google Scholar 

  42. Hatae K, Kimura A, Okubo R, et al. (1992) Genetic control of non responsiveness to hepatitis B virus vaccine by an extended HLA haplotype. Eur. J. Immunol. 22: 1899–1905.

    Article  CAS  PubMed  Google Scholar 

  43. Salgame P, Convit J, Bloom BR. (1991) Immunological suppression by human CD8+ T cells is receptor dependent and HLA-DQ restricted. Proc. Natl. Acad. Sci. U.S.A. 88: 2598–2602.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Sasazuki T, Kikuchi K, Hirayama S, Matsushita S, Ohta N, Nishimura Y. (1989) HLA-linked immune suppression in humans. Immunology S2: 21–25.

    Google Scholar 

  45. Chen L, Thomas EK, Hu SL, Hellstrom J, Hellstrom KE. (1991) Human papillomavirus type 16 nucleoprotein E7 is a tumour rejection antigen. Proc. Natl Acad. Sci. U.S.A. 88: 110–114.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Acknowledgements to Dr. A. Hollingworth, Dr. A. Szarewski, and Prof. A. Singer for samples, and Dr. M. Anderson and Dr. A. M. Hanby for histological diagnosis, and Dr. R. Edwards for statistical analysis. Supported by the Imperial Cancer Research Fund and Wellbeing.

Author information

Authors and Affiliations

  1. ICRF Molecular Oncology Laboratories, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, OX3 9DU, UK

    Kunle Odunsi &  Trivadi S. Ganesan

  2. Departments of Molecular Pathology and Medical Microbiology, University College, London, UK

    George Terry & Linda Ho

  3. Nuffield Department of Medicine, John Radcliffe Hospital, Oxford, UK

    John Bell

  4. Department of Mathematics, Statistics, and Epidemiology, Imperial Cancer Research Fund, London, UK

    Jack Cuzick

Authors
  1. Kunle Odunsi
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. George Terry
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Linda Ho
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. John Bell
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jack Cuzick
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Trivadi S. Ganesan
    View author publications

    You can also search for this author in PubMed Google Scholar

Rights and permissions

Reprints and permissions

About this article

Cite this article

Odunsi, K., Terry, G., Ho, L. et al. Association Between HLA DQBl * 03 and Cervical Intra-epithelial Neoplasia. Mol Med 1, 161–171 (1995). https://doi.org/10.1007/BF03401564

Download citation

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/BF03401564

Molecular Medicine

ISSN: 1528-3658